If a DNA sequence was 5'-AATGCGGATTT-3' in one strand. What would be the sequence in the other strand? DNA chains are directional (like polypeptide chains) and anti-parallel. 5' and 3' are references to one end or the other.
| 5'-AATGCGGATTT-3' |
| 3'-AATGCGGATTT-5' |
| 3'-TTACGCCTAAA-5' |
| 5'-TTACGCCTAAA-3' |
| 3'-TTTAGGCGTAA-5' |
DNA base pairing rules
* A with T – the purine base adenine always pair with the pyrimidine base thymine and vice versa
* C with G – the purine base cytosine always pair with the pyrimidine base guanine and vice versa
DNA strands are antiparellel. The given sequence direction is 5’ to 3’. Thus the direction of second strand is 3’ to 5’.
Answer : Option 3
3'-TTACGCCTAAA-5'
If a DNA sequence was 5'-AATGCGGATTT-3' in one strand. What would be the sequence in the...
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence of the complementary stand?
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
Given the following DNA sequence (it is the sense/nontemplate strand): 5’ CGTCTAATGAGgaattatgagGCACGTTGACTCGGgacttcatgGCTGACATCC 3’ If the bolded Guanine is depurinated such that it now pairs with an Adenine, what kind of mutation would result upon replication? How could you describe what happens to the polypeptide that is made? What is the resulting polypeptide? If an Adenine is inserted between the two bolded “T”s what kind of mutation is this? How would we describe what happens to the polypeptide that is made?...
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'