Question

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the...

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer has been attached below. Hope this will help

Add a comment
Know the answer?
Add Answer to:
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT