Question

The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains...

The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains the information needed to code for a peptide? Why? i: 5’ UUUGCUAAAGACCUAGAAUU 3’ ii: 5’ CCUCCAUGCCGCUAUACUUA 3’ iii: 5’ CAUGUAACCGCUCGAGGAUA 3’ iv: 5’ AACCUUCUUAGAGGCCCCUA 3’

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The sequence that is capable of coding for a peptide is:

ii: 5’ CCUCCAUGCCGCUAUACUUA 3’

As this sequence contanis both start codon AUG as well as stop codon UUA with some codons in the middle that can code for aminoacids in the peptide.

Add a comment
Know the answer?
Add Answer to:
The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT