The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains the information needed to code for a peptide? Why? i: 5’ UUUGCUAAAGACCUAGAAUU 3’ ii: 5’ CCUCCAUGCCGCUAUACUUA 3’ iii: 5’ CAUGUAACCGCUCGAGGAUA 3’ iv: 5’ AACCUUCUUAGAGGCCCCUA 3’
The sequence that is capable of coding for a peptide is:
ii: 5’ CCUCCAUGCCGCUAUACUUA 3’
As this sequence contanis both start codon AUG as well as stop codon UUA with some codons in the middle that can code for aminoacids in the peptide.
The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains...