Modify main.ino such that the waveform becomes triangular shape and symmetrical. That means the voltage goes from 0 to peak, then comes down back to 0, in equal amount of time.
Homework Answers
void loop()
{
for (int var=0;var<4095;var +=100)
{
if var<4095/2
{
dac.output(var);
delayMicroseconds(10);
}
else
dac.output(4095-var);
delayMicroseconds(10);
}
}
Add Answer to:
Modify main.ino such that the waveform becomes triangular shape and symmetrical. That means the v...
This question is about the Arduino code. Please complete a 4-input circuit on your Arduino. Your...
This question is about the Arduino code.
Please complete a 4-input circuit on your Arduino. Your circuit,
in addition to cycling through a binary representation of the
numbers 0-15 using LEDs, should use the Serial port to output the
decimal equivalent of each of the numbers in the format:
Output: 15
... if the value was 1111, and so forth.
You will be asked to upload your code as well as a photo of your
working breadboard circuit.
Add comments...
ARM assembly using breadboard Ladder Game - This game involves a setup of LEDs in a...
ARM assembly using breadboard Ladder Game - This game involves a setup of LEDs in a row and a button. The goal is to get from the bottom led all the way to the top without them resetting. The LEDs will flash and you can only move up one led at a time, when the led is lit up, or else you get reset to the bottom. code in C please convert to ARM assembly #include <stdio.h> #include <stdlib.h> #include...
This is a revision of a previous exercise, here is the question: Perform exercise 4 at...
This is a revision of a previous exercise, here is the question: Perform exercise 4 at the end chapter 8 of your textbook using dynamic arrays. (This time the program must use dynamic arrays). I have regular array version posted below. C++: Write a program that reads a file consisting of students’ test scores in the range 0-200. It should then determine the number of students having scores in each of the following ranges: 0-24, 25-49, 50-74, 75-99, 100-124, 125-149,...
Please Modify TestPart2 to test the correctness and efficiency of FasterDefaultList. Thanks import java.util.List; import java.util.AbstractList;...
Please Modify TestPart2 to test the correctness and
efficiency of FasterDefaultList. Thanks
import java.util.List;
import java.util.AbstractList;
import java.util.Map;
import java.util.HashMap;
public class DumbDefaultList<T> extends AbstractList<T> {
Map<Integer,T> map;
public DumbDefaultList() {
map = new HashMap<Integer,T>();
}
public int size() {
return Integer.MAX_VALUE;
}
public T get(int i) {
return map.get(i);
}
public T set(int i, T x) {
return map.put(i, x);
}
public void add(int i, T x) {
Map<Integer, T> map2 = new HashMap<Integer,T>();
for (Integer k : map.keySet())...
Please Complete the following C Code with Comments explaining your solution and post a screenshot of...
Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...
Rules of implementation!: You may NOT modify any of the files except Expression.java in ANY way....
Rules of implementation!: You may NOT modify any of the files except Expression.java in ANY way. You may NOT make ANY modifications to Expression.java EXCEPT: Write in the bodies of the methods you are asked to implement, Add private helper methods as needed (including the recursive evaluate method discussed below.) Note that the java.io.*, java.util.*, and java.util.regex.* import statements at the top of the file allow for using ANY class in java.io, java.util, and java.util.regex without additional specification or qualification....
Edit a C program based on the surface code(which is after the question's instruction.) that will...
Edit a C program based on the surface code(which is after the question's instruction.) that will implement a customer waiting list that might be used by a restaurant. Use the base code to finish the project. When people want to be seated in the restaurant, they give their name and group size to the host/hostess and then wait until those in front of them have been seated. The program must use a linked list to implement the queue-like data structure....
Please zoom in so the pictures become high resolution. I need three files, FlashDrive.cpp, FlashDrive.h and...
Please zoom in so the pictures become high resolution. I need
three files, FlashDrive.cpp, FlashDrive.h and user_main.cpp. The
programming language is C++. I will provide the Sample Test Driver
Code as well as the codes given so far in text below.
Sample Testing Driver Code:
cs52::FlashDrive empty;
cs52::FlashDrive drive1(10, 0, false);
cs52::FlashDrive drive2(20, 0, false);
drive1.plugIn();
drive1.formatDrive();
drive1.writeData(5);
drive1.pullOut();
drive2.plugIn();
drive2.formatDrive();
drive2.writeData(2);
drive2.pullOut();
cs52::FlashDrive combined = drive1 + drive2;
// std::cout << "this drive's filled to " << combined.getUsed( )...
Assignment Predator / Prey Objectives Reading from and writing to text files Implementing mathematical formulas in...
Assignment Predator / Prey Objectives Reading from and writing to text files Implementing mathematical formulas in C++ Implementing classes Using vectors Using command line arguments Modifying previously written code Tasks For this project, you will implement a simulation for predicting the future populations for a group of animals that we’ll call prey and their predators. Given the rate at which prey births exceed natural deaths, the rate of predation, the rate at which predator deaths exceeds births without a food...
Infix Expression Evaluator For this project, write a C program that will evaluate an infix expression. The algorithm REQ...
Infix Expression Evaluator For this project, write a C program that will evaluate an infix expression. The algorithm REQUIRED for this program will use two stacks, an operator stack and a value stack. Both stacks MUST be implemented using a linked list. For this program, you are to write functions for the linked list stacks with the following names: int isEmpty (stack); void push (stack, data); data top (stack); void pop (stack); // return TRUE if the stack has no...
This question is about the Arduino code.
Please complete a 4-input circuit on your Arduino. Your circuit,
in addition to cycling through a binary representation of the
numbers 0-15 using LEDs, should use the Serial port to output the
decimal equivalent of each of the numbers in the format:
Output: 15
... if the value was 1111, and so forth.
You will be asked to upload your code as well as a photo of your
working breadboard circuit.
Add comments...
Please Modify TestPart2 to test the correctness and
efficiency of FasterDefaultList. Thanks
import java.util.List;
import java.util.AbstractList;
import java.util.Map;
import java.util.HashMap;
public class DumbDefaultList<T> extends AbstractList<T> {
Map<Integer,T> map;
public DumbDefaultList() {
map = new HashMap<Integer,T>();
}
public int size() {
return Integer.MAX_VALUE;
}
public T get(int i) {
return map.get(i);
}
public T set(int i, T x) {
return map.put(i, x);
}
public void add(int i, T x) {
Map<Integer, T> map2 = new HashMap<Integer,T>();
for (Integer k : map.keySet())...
Please zoom in so the pictures become high resolution. I need
three files, FlashDrive.cpp, FlashDrive.h and user_main.cpp. The
programming language is C++. I will provide the Sample Test Driver
Code as well as the codes given so far in text below.
Sample Testing Driver Code:
cs52::FlashDrive empty;
cs52::FlashDrive drive1(10, 0, false);
cs52::FlashDrive drive2(20, 0, false);
drive1.plugIn();
drive1.formatDrive();
drive1.writeData(5);
drive1.pullOut();
drive2.plugIn();
drive2.formatDrive();
drive2.writeData(2);
drive2.pullOut();
cs52::FlashDrive combined = drive1 + drive2;
// std::cout << "this drive's filled to " << combined.getUsed( )...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago