Question

Modify main.ino such that the waveform becomes triangular shape and symmetrical. That means the voltage goes from 0 to peak, then comes down back to 0, in equal amount of time.

#include «SPI.h> #include <DAC MCP48x1.h» #define SS PIN 10 DAC_MCP49x1 daC DAC_MCP49x1:MCP4921, SS_PIN); void setup) put you

Comments
    0 0
    Add a comment Improve this question Transcribed image text
    Answer #1

    void loop()
    {
    for (int var=0;var<4095;var +=100)
    {
    if var<4095/2
    {
    dac.output(var);
    delayMicroseconds(10);
    }
    else
    dac.output(4095-var);
    delayMicroseconds(10);
    }
    }
      

    Add a comment
    Know the answer?
    Add Answer to:
    Modify main.ino such that the waveform becomes triangular shape and symmetrical. That means the v...
    Your Answer:

    Post as a guest

    Your Name:

    What's your source?

    Earn Coins

    Coins can be redeemed for fabulous gifts.

    Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
    Similar Homework Help Questions
    • This question is about the Arduino code. Please complete a 4-input circuit on your Arduino. Your...

      This question is about the Arduino code. Please complete a 4-input circuit on your Arduino. Your circuit, in addition to cycling through a binary representation of the numbers 0-15 using LEDs, should use the Serial port to output the decimal equivalent of each of the numbers in the format: Output: 15 ... if the value was 1111, and so forth. You will be asked to upload your code as well as a photo of your working breadboard circuit. Add comments...

    • ARM assembly using breadboard Ladder Game - This game involves a setup of LEDs in a...

      ARM assembly using breadboard Ladder Game - This game involves a setup of LEDs in a row and a button. The goal is to get from the bottom led all the way to the top without them resetting. The LEDs will flash and you can only move up one led at a time, when the led is lit up, or else you get reset to the bottom. code in C please convert to ARM assembly #include <stdio.h> #include <stdlib.h> #include...

    • This is a revision of a previous exercise, here is the question: Perform exercise 4 at...

      This is a revision of a previous exercise, here is the question: Perform exercise 4 at the end chapter 8 of your textbook using dynamic arrays. (This time the program must use dynamic arrays). I have regular array version posted below. C++: Write a program that reads a file consisting of students’ test scores in the range 0-200. It should then determine the number of students having scores in each of the following ranges: 0-24, 25-49, 50-74, 75-99, 100-124, 125-149,...

    • Please Modify TestPart2 to test the correctness and efficiency of FasterDefaultList. Thanks import java.util.List; import java.util.AbstractList;...

      Please Modify TestPart2 to test the correctness and efficiency of FasterDefaultList. Thanks import java.util.List; import java.util.AbstractList; import java.util.Map; import java.util.HashMap; public class DumbDefaultList<T> extends AbstractList<T> { Map<Integer,T> map; public DumbDefaultList() { map = new HashMap<Integer,T>(); } public int size() { return Integer.MAX_VALUE; } public T get(int i) { return map.get(i); } public T set(int i, T x) { return map.put(i, x); } public void add(int i, T x) { Map<Integer, T> map2 = new HashMap<Integer,T>(); for (Integer k : map.keySet())...

    • Please Complete the following C Code with Comments explaining your solution and post a screenshot of...

      Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...

    • Rules of implementation!: You may NOT modify any of the files except Expression.java in ANY way....

      Rules of implementation!: You may NOT modify any of the files except Expression.java in ANY way. You may NOT make ANY modifications to Expression.java EXCEPT: Write in the bodies of the methods you are asked to implement, Add private helper methods as needed (including the recursive evaluate method discussed below.) Note that the java.io.*, java.util.*, and java.util.regex.* import statements at the top of the file allow for using ANY class in java.io, java.util, and java.util.regex without additional specification or qualification....

    • Edit a C program based on the surface code(which is after the question's instruction.) that will...

      Edit a C program based on the surface code(which is after the question's instruction.) that will implement a customer waiting list that might be used by a restaurant. Use the base code to finish the project. When people want to be seated in the restaurant, they give their name and group size to the host/hostess and then wait until those in front of them have been seated. The program must use a linked list to implement the queue-like data structure....

    • Please zoom in so the pictures become high resolution. I need three files, FlashDrive.cpp, FlashDrive.h and...

      Please zoom in so the pictures become high resolution. I need three files, FlashDrive.cpp, FlashDrive.h and user_main.cpp. The programming language is C++. I will provide the Sample Test Driver Code as well as the codes given so far in text below. Sample Testing Driver Code: cs52::FlashDrive empty; cs52::FlashDrive drive1(10, 0, false); cs52::FlashDrive drive2(20, 0, false); drive1.plugIn(); drive1.formatDrive(); drive1.writeData(5); drive1.pullOut(); drive2.plugIn(); drive2.formatDrive(); drive2.writeData(2); drive2.pullOut(); cs52::FlashDrive combined = drive1 + drive2; // std::cout << "this drive's filled to " << combined.getUsed( )...

    • Assignment Predator / Prey Objectives Reading from and writing to text files Implementing mathematical formulas in...

      Assignment Predator / Prey Objectives Reading from and writing to text files Implementing mathematical formulas in C++ Implementing classes Using vectors Using command line arguments Modifying previously written code Tasks For this project, you will implement a simulation for predicting the future populations for a group of animals that we’ll call prey and their predators. Given the rate at which prey births exceed natural deaths, the rate of predation, the rate at which predator deaths exceeds births without a food...

    • Infix Expression Evaluator For this project, write a C program that will evaluate an infix expression. The algorithm REQ...

      Infix Expression Evaluator For this project, write a C program that will evaluate an infix expression. The algorithm REQUIRED for this program will use two stacks, an operator stack and a value stack. Both stacks MUST be implemented using a linked list. For this program, you are to write functions for the linked list stacks with the following names: int isEmpty (stack); void push (stack, data); data top (stack); void pop (stack); // return TRUE if the stack has no...

    ADVERTISEMENT
    Free Homework Help App
    Download From Google Play
    Scan Your Homework
    to Get Instant Free Answers
    Need Online Homework Help?
    Ask a Question
    Get Answers For Free
    Most questions answered within 3 hours.
    ADVERTISEMENT
    ADVERTISEMENT