Question

If you are planning to make a protein stabilized beverage, which emulsification method (rotor- st...

if you are planning to make a protein stabilized beverage, which emulsification method (rotor- stator, a microfluidizer and the high pressure) you would choose, give your reason.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

role a pohn 2 aide and Sol tion ke con chode h VScoSily ard a Guil

Add a comment
Know the answer?
Add Answer to:
If you are planning to make a protein stabilized beverage, which emulsification method (rotor- st...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 9 Interpret your results: a In which tube(s) did protein digestion occur? How do you know?...

    9 Interpret your results: a In which tube(s) did protein digestion occur? How do you know? b In which tube(s) did no protein digestion occur? How do you know? c What effect does pH have on protein digestion with pepsin? Why? d What other effects does acid have in the stomach? Procedure 3 Demonstrate Lipid Emulsification Let's examine what happens during the process of emulsification. In this exercise you will use four substances to observe emulsification in action: 1 Lipids:...

  • You would like to purify protein A (pI=6.0, MW=32 kDa) from a mixture that also contains...

    You would like to purify protein A (pI=6.0, MW=32 kDa) from a mixture that also contains protein B (pI=6.0, MW 32 kDa) and peptide C (pI=5.5, MW= 3 kDa). Which one of the following techniques would give you the best possible result? a) High Pressure Liquid Chromatography (HPLC) b) Gel Filtration c)Ion Exchange d)Affinity Chromatography e) SDS-PAGE

  • A. You want to make a translational fusion of protein Z and the yellow fluorescent protein...

    A. You want to make a translational fusion of protein Z and the yellow fluorescent protein YFP (Z-YFP) so that expression of the fusion occurs with the same cell-specific pattern as that of protein Z. The protein Z gene has a 2 kb promoter, two 1 kb exons, and one 5 kb intron. The YFP gene is 0.7 kb. Outline with words and sketches your strategy to make the Z-YFP fusion clone using PCR. You already have cells that contain...

  • Suppose you are working on a gene that encodes a protein that triggers apoptosis of the...

    Suppose you are working on a gene that encodes a protein that triggers apoptosis of the cell (programmed cell death). In a certain cell, this gene is transcriptionally ON, that is, primary transcript is being made. Choose a mechanism by which to prevent or reduce the production of active apoptosis protein, and describe the specific properties of the new regulatory protein that the cell would have to make in order to do this.

  • You are given the following sequence of DNA which encodes for a short protein (this is...

    You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...

  • You are analyzing a protein that you believe affects endocytosis, but you are not sure which...

    You are analyzing a protein that you believe affects endocytosis, but you are not sure which stage. You create cells with your gene of interest mutated in the genome, and a tet-off system driving a wild-type (WT) copy of your gene (tet-off allows a specific gene to be turned off by adding a tetracycline family drug). After confirming that the system works, you culture the cells with and without tetracycline and in the presence of very high levels of EGF....

  • a Two computer firms, A and B, are planning to market network systems for office information...

    a Two computer firms, A and B, are planning to market network systems for office information management. Each firm can develop either a fast, high-quality system (High), or a slower, low-quality system (Low). Market research indicates that the resulting profit to each firm for the alternative strategies are given by the payoff matrix to the right Firme Firm B If both firms make their decisions at the same time and follow maximin (low-risk) strategies, what will the outcome be? High...

  • compare the difference of recycling method the question 3 Over the world, humans consumed up to...

    compare the difference of recycling method the question 3 Over the world, humans consumed up to million of plastic water bottles per minute. Plastic water bottles are generally made from polyethylene terephthalate (PET), which is non- biodegradable in nature. Thus, most of these plastic bottles are end up in either the ocean or in a landfill. Then, the plastic bottles waste caused a serious issue to our environment. For this reason, many beverage packaging companies are planning to replace their...

  • Question 4 [25 marks] An electric motor drives a coaxial rotor through a single-plate clutch which...

    Question 4 [25 marks] An electric motor drives a coaxial rotor through a single-plate clutch which has two pairs of driving surfaces each 300 mm external and 175 mm internal diameter. The variation of normal pressure with radius is given by a + b/r Pa and the maximum pressure is 150 kPa. The spring force on the system is 500 N. The mass of the motor armature and shaft is 750 kg and its radius of gyration is 240 mm;...

  • What percent of total kcals came from protein? Are you within recommendations (AMDRs) for protein? Why...

    What percent of total kcals came from protein? Are you within recommendations (AMDRs) for protein? Why is adequate protein necessary for the body (think functions of protein)? What are the consequences of a diet too low in protein? What are the consequences of a diet too high in protein? Why is it important to consider saturated fat grams when choosing sources of protein? How can you decrease fat and retain protein grams? How does your intake compare to your recommendation?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT