exptensive response Please! more= better. thank you so much.
What forms of discipline/correction are effective and have good outcomes for children? Keep in mind that there are many different views and not one single correct way to be a parent.
Simple terms discipline is correcting the behaviour and training to follow the code of behaviour.
Love and trust are the best tools to enforce discipline in children . Scolding or punishing will not help in any way. Mutual trust helps the children to be non judgemental against parents.
The effective discipline is reinforced in children to bloom tolerative and suitable behaviour .For implementing effective discipline in children , the parent should be disciplined. Parents are the role models to the children . The children will portrait the behaviour of parents. So donot shout or yell at your child .Harsh discipline will never succeed. The mutual respect in reasonable and consistent way between parent and child is effective discipline.
Talk with the children about the need to follow and respect parents and other authorities which in turn may promote self discipline and instill values. Discipline also helps the children to sense danger and have a healthy mental capacity to grow into a bright resilent adult.
The children may behave in different manners according to their age. First the parent should have knowlegde about the behaviour of children in each stage to enforce discipline in children . The parent should understand that the child may have some disturbances which can be resolved if handled in appropriate manner. Provide the privelege to your child . Help them to learn from the consequences of any disappropriate behaviour .Education is also a way to implement effective discipline .
Before correcting any inappropriate behaviour in children , a parent should look for the reason behind the cause for the inappropriate behaviour and resolve it , so it will not happen again.
Allow a child to play with other children which helps in building mental health capacity, improve bonding, happiness and also they may know their limits. Donot compromise on safety of children . Disapproval at sometimes be helpful for correcting the behaviour. Appraising and encouragement can mold a child to grow . Donot restrict or draw a boundary to keep the child within.
Allow them to discover the happiness which will be a effective way to make them well disciplined.
exptensive response Please! more= better. thank you so much. What forms of discipline/correction are effective and...
Please answer ALL of them. Thank you so much in advance! 1. What is the probability of rolling snake eyes? 2. What is the probability of getting 2 boys and 2 girls in a family of 4 children (pascal's triangle is handy here) 3 Some says they have 2 children but they are not both girls, knowing that what are the odds that they are both boys? 4. What are the odds of flipping a coin 5 times and getting...
Public health class question, ASAP please and need to be detail Thank you so much!!! 1. Compare and Contrast the biological framework and the socio-ecological framework for public health. Select a single disease/risk factor that would best be approached from and biological framework, and another that would best be approached from a socio-ecological framework. Justify your answer. 2.Select one disease and a single risk factor. Describe one current way in which public health is addressing that risk factor. explain the...
Hello, please please help me with this, I would greatly
appreciate it!!!!
THANK YOU SO MUCH!!!
QUESTION 3 When first presented with a pedigree, you should initially look for general trends. For example: Are there affected individuals in each generation? Are both males and females equally affected? Are traits from a father or mother passed on to all their children? Or only to their sons or daughters? Based on these general observations, you can usually make a fairly reasonable guess...
38-40 please! the end of 38 is “one way ANOVA, t=“ thank you so
much in advance
parameter is ca y between a sample statistics and its corresponding d) the sampling error 35) Which of the following is the key feature of random assignment? a) All participants have an equal chance of being selected into a study All participants have an equal chance of completing a study b) c) All participants have an equal chance of being placed in any...
Please show all work! Thank you so much
4. (0.5pt) When a single compound contains both a nucleophile and a leaving group, an intramolecular reaction may occur. With this in mind, draw the product of the following reaction. OHS но CH1002 Br Br Bro 5. (7pts) Draw a stepwise, detailed mechanism for the following reaction. N. ci CH3NH2 (excess) CH3NH3
Hi this is discussion from my classmate,so can anyone please response to this discussion. please response as long as u can. thanks. 5 qualities of the perfect drug would be: 1. Non-toxic with no side effects and less medication errors, this is important so people do not worry more about the side effects of the drug they are taking. 2. Controllable that way you can predict how the drug is affecting the rate of it being released into the body....
Please and thank you list with clean writing thank you so
much!
What is Taxable? Learning Objectives: sort out taxable/nontaxable income streams and calculate taxable income We return make ends streams. They have both sat down and written out a general picture of everything they anticipate to Emerson and Nevada who are between career jobs. They are now married, and in order to meet, they are working a number of part-time jobs and have some additional income needing for tax...
Please need help with this questions Thank you so much. what do you think should be done in management training to make a manager successful when he/she will want to be a leader? Do you think the training should be personalized? A public health leader needs to possess traits and skills such as communication skills, demonstration of shared values, resilience, interpersonal skills, openness, problem solving skills, social skills, adaptability as well as other extraversion traits ". In this case, in...
Please provide justifications for all answers so I
understand. Extra detail is very helpful. Thank you so
much.
Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...
Please offer a detailed explanation. Thank you so much.
Which of the following compounds are aromatic? Select all that apply. CH3 | වියේදී,00 CH3 (6Multiple answers: You can select more than one option O A 1 0 B 2 o c 3 | 5