Question

Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you so much.

Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give an example of a different type of mutation in the same position. What type of mutation is this? (2pt) D. What differentiates the way these two mutations impact the translation process? How does this lead to these two different outcomes? (2pt)

Answer 1

A)

• In the given DNA sequence the direction of the DNA is not mentioned .
• It must be in 5' to 3' direction .
• But mRNA synthesis takes place in 5' to 3' direction of DNA .
• So the above sequence become inverted GAATTT.............AAT
• The mRNA sequence for inverted DNA would become
• 5'-------------GUUAAACUCCCAUACCGUGGGAUAUACAUUA------- 3'
• The UAA in Bold italics is stop codon . So protein synthesis from the direction 3' to 5' gives 8 aminoacid protein .
• Open reading frame 3 gives eight aminoacid protein.
• 5'-------------GU UAA ACU CCC AUA CCG UGG GAU AUA CAU UA------- 3'
• UAA is stop codon.

b)

• Third aminoacid is AUA - codes for isoleucine .
• If silent mutation changes AUA to AUU , still AUU codes for isoleucine.\

c)

• Point mutation AUA gets ACA .
• Here U gets converted to C . This new codon codes for theronine and not for isoleucine .
• This causes change in the total protein structure.

d)

• Earlier in silent mutation even though one base is changed , still the same protein is produced containing same aminoacids.
• But later in point mutation , different aminoacid is produced and thus different protein .
• Both protein has different characteristics.

g)

• The process of movement of proteins from ER to plama membrane is called protein translocation.
• The signal sequence in the protein directs the protein to its respective destination . Here the protein is destined to plasma membrane .
• If the NH3 terminal of protein is destined to extra cellular side of Plama membrane then in ER the protein amino terminal would be i n cytosol.