Question
  1. Please note that Questions 15 to 17 are connected questions.

    Question 15:

    The following shows a partial DNA sequence from the wild-type (normal) allele for the human leukemia-linked apoptotic gene.  

    5' ATGCGATTAATCGGTAAA 3' (non-template strand)

    3' TACGCTAATTAGCCATTT 5' (template strand)

     

    Please answer the following questions:

    (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence?

    The mRNA sequence is  5'  3'. (2 marks)

    5' AUG CGA UUA AUC GGU AAA 3' ?

    Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.

    Carefully check that the sequence you input contains no typographical mistakes.

      

    (b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

    The amino acid sequence for this protein is N-terminus  C-terminus. (2 marks)

    Met-Arg-Leu-Ile-Gly-Lys ?

    Please note:

    • The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

      • i.e., input the amino acids in the order that they would be translated.

    • If a codon encodes for a stop codon, type STOP. (Do not translate any codons after a STOP codon, as a STOP codon signals to the translation machinery to disassemble.)

    • When inputting your sequence, separate each amino acid with a hyphen (e.g., Ser-Tyr-STOP).

    • You will need to consult the genetic code to answer this question (one is shown above in Question 10, or you can consult Figure 11.5 in your textbook).

4 points   

QUESTION 16

  1. Please note that Questions 15 to 17 are connected questions.

    Question 16:

    The following shows the same partial DNA sequence that was shown above in Question 15, however, this DNA sequence is for themutant allele for the human leukemia-linked apoptotic gene. This mutated allele is suspected to be linked to some forms of cancer, most notably leukemia.

    5' ATGCGATTGATCCGGTAAA 3' (non-template strand)

    3' TACGCTAACTAGGCCATTT 5' (template strand)

     

    Answer the following questions:

    (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele?

    The mutated mRNA sequence is  5'  3'. (2 marks)

    5' AUG CGA UUG AUC CGG UAA A 3' ?

    Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.

    Carefully check that the sequence you input contains no typographical mistakes.

    (b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

    The amino acid sequence for this protein is N-terminus  C-terminus. (2 marks)

    Met-Arg - Leu- Ile - Arg ?

    Please note:

    • The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

      • i.e., input the amino acids in the order that they would be translated.

    • If a codon encodes for a stop codon, type STOP. (Do not translate any codons after a STOP codon (if one exists), as a STOP codon signals to the translation machinery to disassemble.)

    • When inputting your sequence, separate each amino acid with a hyphen (e.g., Ser-Tyr-STOP).

    • You will need to consult the genetic code to answer this question (one is shown above in Question 10, or you can consult Figure 11.5 in your textbook).

4 points   

QUESTION 17

  1. Please note that Questions 15 to 17 are connected questions.

    Question 17:

    Compare both the nucleic acid and protein sequences you determined above in Questions 15 and 16 for the human leukemia-linked apoptotic gene.

    You should have noticed that there are two separate mutations present in the mutant allele compared to the wild-type (normal) allele (if you cannot identify both of these mutations, please go back and check your work).

    Refer to the first mutation you encounter in the nucleic acid sequence as mutation #1 and the second mutation you encounter in the nucleic acid sequence as mutation #2 (remember we read DNA/RNA in the 5' to 3' direction).

    Answer the following questions:

    (a) Clearly identify where each mutation is located in the mutant allele compared to the wild-type (normal) allele.  (2.5 marks)

    WT AAT mutated to AAC and CCA in WT to GCC. ?

    (b) Classify each mutation according to the classification systems presented to you above in Questions 13 and 14.  (2.5 marks)

    1st mutation is silent mutation - Leu to Leu. 2nd mutation Frameshift mutation "G" is added in the mutated sequence.

    (c) Describe the effect, if any, each of these mutations would likely have on the function of the protein within the cell. (2.5 marks)

    1st mutation have no effect in the function of protein but the 2nd mutation shows greater variation in the function of protein due to frame shift mutation?

    For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac).
    -- Font family --Andale MonoArialArial BlackBook AntiquaComic Sans MSCourier NewGeorgiaHelveticaImpactSymbolTahomaTerminalTimes New RomanTrebuchet MSVerdanaWebdingsWingdings -- Font size --1 (8pt)2 (10pt)3 (12pt)4 (14pt)5 (18pt)6 (24pt)7 (36pt)
    -- Format --HeadingSub Heading 1Sub Heading 2ParagraphFormatted Code -- Font family -- -- Font size --
    mashuplogo.png

    Path: p

    Words:64Please note that Questions 15 to 17 are connected questions. Question 17: Compare both the nucleic acid and protein sequences

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

\rightarrowWILDTYPE SEQUENCE:-

  • DNA - 3' TAC GCT AAT TAG CCA TTT 5'

\rightarrowMutated

  • DNA - 3' TAC GCT AAC TAG GCC ATT T 5'
  • mRNA - 5' AUG CGA UUG AUC CGG UAA A 3'
  • Protein N' Met-Arg - Leu- Ile - Arg C'

A):

  • WT AAT mutated to AAC and CCA in WT to GCC.

B):

  • 1st mutation is silent mutation - Leu to Leu
  • 2nd mutation Frameshift mutation "G" is added in the mutated sequence.

C):

  • 1st mutation have no effect in the function of protein but the 2nd mutation shows greater variation in the function of protein due to frame shift mutaion.

Please Rate My Answer.......Thank.........u...

Add a comment
Know the answer?
Add Answer to:
Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 16: The following shows the same segment of DNA that was shown above in Question...

    Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...

  • I have my own answers, i just want to check my work, thanks! Given the DNA...

    I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...

  • Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...

    Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.

  • Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are...

    Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are these? How do you do the bottom?   Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...

  • You are studying an interesting protein in nematode worms that is 100 amino acids in length....

    You are studying an interesting protein in nematode worms that is 100 amino acids in length. Of particular interest is the fact that the last seven amino acids are all tryptophan (codons 94 through 100). Draw here the mRNA sequence for codons 94-100: Draw here the sequence of the DNA strand RNA polymerase used as its template (show 5' 3' polarity): You mutagenize the wild type worm. Assume for the next questions you are able to isolate both normal and...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • Complete the following table and answer the next two questions (3.5 marts) 10 B I =...

    Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...

  • can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...

    can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as...

    The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT