Question

LUTION 51 The most common mutations are strand of DNA , involving the variation of a single ina a. VTNRs; triglyceride b. ini
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The most common mutations are SNPs involving the variation of a single nucleotide in a strand of DNA.

c. SNPs, nucleotide (As SNP Single nucleotide polymorphisms, as it represents a difference in a single building block, of DNA, called)    

Add a comment
Know the answer?
Add Answer to:
LUTION 51 The most common mutations are strand of DNA , involving the variation of a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • QUESTION 50 All of the following dietary factors protect us against CVD except: a. omega-3 fatty...

    QUESTION 50 All of the following dietary factors protect us against CVD except: a. omega-3 fatty acids b. legumes c. fruits and vegetables d. a low-carbohydrate diet e. fish oils QUESTION 51 The most common mutations are strand of DNA. involving the variation of a single in a a. VTNRs; triglyceride b. initiators; platelet C. SNPs; nucleotide d. moderators, epigenome e. promoters; histone QUESTION 52 1 points Save All Answers Save un ducquate amount of salt-cured foods. QUESTION 48 Identify...

  • 1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription...

    1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription start site is in bold (+1). Draw boxes around and label the consensus sequences found in this type of promoter. 5' AGTTAGGTATTGACATGATAGAAGCACTCTACTATAATTCAATAGGTCCAC 3 2) A partial peptide sequence for the wild type and three mutant alleles of a gene, PET1, are shown below. Each mutant was caused by a substitution, addition, or deletion of a single nucleotide. Determine the exact coding DNA sequence of...

  • 5. About double strand DNA repair, it is correct to say that choose the most appropriate answer):

    5. About double strand DNA repair, it is correct to say that choose the most appropriate answer): (a) It requires one intact strand as a template for error correction. (b) Mismatches in the DNA are usually corrected via double strand DNA repair mechanisms. (c) Homologous recombination usually results in DNA repair with no loss of nucleotide at repair site. (d) Non-homologous end-joining usually results in DNA repair with no loss of nucleotide at repair site. 6. A eukaryote gene has two introns and three exons....

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • Mutations arc changes in the DNA sequence of organisms and are the primary source of variation...

    Mutations arc changes in the DNA sequence of organisms and are the primary source of variation in populations. Brainstorm with your group mates some known mutations in the human population (some examples are provided): Of the mutations listed above, which ones do you predict to affect the "fitness" (ability to reproduce) of the individual? How (is it beneficial or detrimental)? Of the mutations listed above, which ones do you predict to affect the "fitness" (ability to reproduce) of the population?...

  • Which of the following mutations would be most likely to have a harmful effect on an...

    Which of the following mutations would be most likely to have a harmful effect on an organism? (A) a deletion of three nucleotides near the middle of a gene (B) a single nucleotide deletion in the middle of an intron (C) a single nucleotide deletion near the end of the coding sequence (D) a single nucleotide insertion downstream of, and close to, the start of the coding sequence In this problem, why (c) cannot be the answer?? Single nucleotide deletion...

  • Assume that the following single strand of DNA was synthesized using standard dATP, dGTP, dCTP, and...

    Assume that the following single strand of DNA was synthesized using standard dATP, dGTP, dCTP, and dTTP precursors; however, the innermost phosphate (alpha phosphate) of all the dATPs was labeled with 32P. 3' - CTAGTAT - 5' Assume also that the strand was degraded to completion by the enzyme spleen diesterase. Spleen diesterase cleaves DNA at the covalent bond that connects the 5' carbon of the sugar to the phosphate. Which of the resulting nucleotide(s) might now carry the 32P?...

  • 2. Classify the following mutations in the coding strand of DNA above. Would the mutation have...

    2. Classify the following mutations in the coding strand of DNA above. Would the mutation have any effect on the protein? Point mutations include: silent, AA substitution and stop. Frameshifts include insertions and deletions of nucleotides. GAC a. If GAT was mutated to GAC CTO CUG leu = Silent b. If GAT was mutated to GAA CTT GAC GAA Guit = mysense C. If TAC was mutated to TAAG AA Агт чR АВЧ МАА acuu d. If TAC was mutated...

  • 1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning...

    1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning properly? photoreactivation repair base excision repair SOS repair double-strand break repair nucleotide excision repair 2. In bacteria and eukaryotes, a mutation is when ________. In bacteria and eukaryotes, a mutation is when ________. A.the nucleotide sequence in an mRNA molecule is directly changed B.the nucleotide sequence in a DNA molecule is directly changed C.the amino acid sequence in a protein molecule is directly changed...

  • Which enzyme lays down the signal for DNA polymerase to bind and start creating the complementary...

    Which enzyme lays down the signal for DNA polymerase to bind and start creating the complementary strand of DNA? Which enzyme helps relieve tension in the DNA strand as it is pulled apart for replication? What specific structure is needed in order for DNA polymerase to start DNA replication? Select one: a. RNA primer b. DNA primer c. DNA polymerase d. nucleic acid e. nucleotide sequence Which of these is unique to the lagging strand of DNA? Select one: a....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT