Question

5-GCATGAGTCTGGTACGCTTTTAAAGC-3 3-CATGCG-5 IIIII 3. (a) in the sequence above, what enzyme would you need to extend the sho
After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the 10th p
Lou Gehrig disease (aka ALS, amyotrophic lateral sclerosis) is a condition of progressive weakness and wasting of skeletal mu
Complete the drawing of a trinucleotide, number carbon atoms within the sugar components, indicate the nitrogenous bases and
We are looking at a schematic of a replication fork. (a) Which strand (B or D) is showing leading strand synthesis? (b) Name

genetic biology
0 0
Add a comment Improve this question Transcribed image text
Answer #1

3. a) Primase enzyme makes an RNA primer, or short stretch of nucleic acid complementary to template, that provides 3' end for DNA polymerase to work on.

b) 3'CGTACTCAGACCATGCGAAAATTTCG5'

c) Phosphodiester bond

Mutations- Transversion

Transition

Induced point mutations

a) At the elongation stage expansion occurs.It includes repeat expansion within exon 1 of gene.

b) probability is 50 percent. because Prisha is a carrier.

Someone with autosomal dominant FALS has one copy of the gene with a mutation and one copy of the gene without a mutation. A child born to someone with FALS has a 50% chance of inheriting the FALS gene mutation and a 50% chance of inheriting the gene without the mutation.

Attaching image of trinucleotide DNA

DMTOO Base RO-P=0 07 Base RO-P=0 0-0 Basez R= c N ON CH3 H3C^CH3NH3 | 0 0— P=0 го—p=0 N NH2 о с нь дун o-p=0 тг Осн, сухо 0 ОН The DNA trinucleotide C-G-T

one of the major structural differences between DNA and RNA is sugar with the 2-deoxyribose in the DNA being replaced by ribose in RNA.

a) according to image B is a leading strand synthesize continuosly and  D is a lagging strand.

b) multiple proteins are required, DNA polymerase, SS DNA binding protein, Helicases, primase, topoisomerases and DNA gyrases.

c) telomerase adds complementary RNA bases to 3'end of DNA strand. so according to the image A will need to have telomerase activity.They function to protect the end of chromosomes from sticking to each other. They also protect genetic information during cell division because a short piece of each chromosome is lost every time its DNA is replicated.

Add a comment
Know the answer?
Add Answer to:
genetic biology 5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 9 (1 point) Figure out the mutation. You will need the codon table for this...

    Question 9 (1 point) Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a really small gene and matching complete amino acid sequence of its gene product GGT ATG GGG ACT TTG AGG ATG ATA AGG CGT AAA TAA ATAT Met Gly Thr Leu Arg Met Ile Arg Arg Lys A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the likely mutation? between...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • base pairing Done stand is positively charged and th one strand contains only purind e DNA...

    base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that wind the DNA strands during replication A. helicase B. mucienne E primase D. DNA polymerase 41) The leading and the lasing and differ in that A) the leading strand is synthesized in the same direction is the movement of the replication fork, and the lagring strand is synthesized in the opposite direction B) the leading...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • 18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to...

    18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to the follo DNA :3TAC GCT GAG AGA GAC ACTS sº ATG CGA CTC TCT CTG TGA 3» 18b. (2pts) Does this mutation change the amino acid sequence? If yes - what is 18c. (2pts) Can this mutation change the way the protein functions? 18d. (2pts) How can a DNA mutation change protein function? Explain your answer in terms of gene expression. 15. Answer the...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 1 e and 2 e 1 need help on those. ive posted this multiple times and...

    1 e and 2 e 1 need help on those. ive posted this multiple times and peolle have anawered . but both times i posted they have given me two diff reaponses for the answers. please help for 1e and 2e. if u coild look at the chart and decide the sequences for me please be simple and clear 3rd base in codon puco sucopucobuco 2nd base in codon CAIG SS2288 222222233&a The Genetic Code 1st base in codon Norma...

  • The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure...

    The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT