The TATA binding protein binds to _______________.
|
the promoter in eukaryotes. |
||
|
the promoter proximal element. |
||
|
the +1 transcription start site |
||
|
the promoter in prokaryotes. |

The TATA binding protein binds to _______________. the promoter in eukaryotes. the promoter proximal element. the...
Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter TATA-Binding Protein (TBP) RNA polymerase + sigma factor enhancer TATA-box gene-specific transcription factors RNA polymerase + GTFs phosphodiester bonds -10 and -35 consensus sequences mediator protein +1 Transcriptional Start Site (TSS) deoxynucleoside triphosphates (dNTPs) template DNA RNA transcript.
Identify the statements that are features of a promoter. Pick all that Apply. A. In eukaryotes, the promoter recruits the preinitiation complex, which includes the TATA-binding protein. b. In prokaryotes, the promoter is recognized by general transcription factors (GTF), which recruit the RNA polymerase holoenzyme. c. In eukaryotes, the promoter attracts the small and large ribosomal subunits with the help of initiation factors. d. In prokaryotes, the promoter contains a –35 and –10 region upstream of the transcription start site...
Question 6 During initiation of transcription in eukaryotes, binds the within the promoter. TFIID, TATA box Sigma subunit, -35 and -10 sequence TFIIH, TATA box TFIIB, -35 and -10 sequence
If a protein binds to a DNA sequence downstream of a promoter, transcription is enhanced. Which site is likely to be attached?
What is the function of the TATA binding protein (TBP)? Group of answer choices aids in the removal of introns from eukaryotic pre-mRNA allows prokaryotic RNA polymerase to bind to the promoter of genes allows eukaryotic RNA polymerase II to bind to the promoter of genes helps termination factors bind and terminate transcription. All of the answer options are correct.
What gene regulation mechanism do eukaryotes share with prokaryotes? OA) Varying the promoter sequence to vary the binding affinity of general transcription factors. OB) Regulating the expression from a single gene with several specific transcription factors. C) Controlling gene expression by restricting access to the promoter. D) Driving the expression of several genes with one promoter. OE) Controlling the expression from a single gene with several general transcription factors.
A protein binds a DNA sequence downstream of a promoter. This results in an increased rate of transcription of the gene. Which of the following site is likely to be attached? a. Operon b. Terminator c. Activator binding site d. Promotor The following are produced by algae To prepare the insert for the gene cloning, you need to find a proper source of the DNA fragment. PCR is one of the most common ways to get the gene that you...
QUESTION 9 Regulation of gene expression by eukaryotes is more complicated that in prokaryotes. The promoter region contains proximal regulatory sequences that are called _regulatory elements. These proximal regulatory elements bind trans-acting proteins that are called __factors.
QUESTION 9 Regulation of gene expression by eukaryotes is more complicated that in prokaryotes. The promoter region contains proximal regulatory sequences that are called _regulatory elements. These proximal regulatory elements bind trans-acting proteins that are called __factors.
22. The following is a promoter that is recognized by the sigma (?) factor of the E. coliRNA polymerase: 5’-ACGAAAAACAGGTATTGACATCATGAAGTAACATGCAGTATAATACAAATCG The bold Gdenotes the transcription start site (+1). Underline, highlight or type the cis-acting elements that will be recognized by the sigma factor. 23. The following sequence is a portion of a eukaryotic promoter. The transcription start site is indicated as the red/bold “g”. 5’-CGGCTCAATAAAATAACAGGAGTCTATAAAAGCGTGGGGACAGTTCAGGAGGGG TBP binds a cis-acting element within this sequence. What is the coordinate (e.g. +5, -5...