Question

4 (2pts) Your sequence of DNA is S CGTTACACOTGGACTGAGGATGTAGCCAT 3. What is the sequence of the longest peptide that can be produced from this doublestranded template? The labeled base is mutated from a G to T. What is the result of this change?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The polypeptide is, -Ala-cys-

Add a comment
Know the answer?
Add Answer to:
4 (2pts) Your sequence of DNA is S CGTTACACOTGGACTGAGGATGTAGCCAT 3". What is the sequence of the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...

    The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5- TTATTCTTTAAT CAT-3 What would be the consequences of the highlighted A to be mutated to a G? Select one: a. The resulting peptide will likely be larger than the non-mutant peptide b. the primary sequence of the peptide will be different on one amino acid O C. The peptide sequence would be the same d. all the amino acids after...

  • The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...

    The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5'- TTATTCTTTAAT CAT-3' What would be the consequences of the highlighted A to be mutated to a G? Select one: a. the primary sequence of the peptide will be different on one amino acid b. all the amino acids after the mutation will be different than the non-mutant peptide c. The peptide sequence would be the same d. The resulting peptide...

  • Use the DNA sequence below and the genetic code in your text to answer the following...

    Use the DNA sequence below and the genetic code in your text to answer the following questions. Template DNA 3ʹ T A A G C G A T A C G A G A 5ʹ Non-template DNA 5ʹ A T T C G C T A T G C T C T 3ʹ What is the RNA sequence that would be transcribed from the sequence above? Include the 3ʹ and 5ʹ ends. (0.5) b) What is the amino acid sequence...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • The transcribed portion of a DNA sequence for a gene is shown below

    The transcribed portion of a DNA sequence for a gene is shown below. Identify the mRNA sequence and the polypeptide sequence that would be produced from this gene. Also, identify the specific type of DNA mutation and protein mutation that would result if the underlined A/T basepair was mutated to a C/G basepair. NOTE: Assume RNA polymerase is moving left to right across the page. 3' - TATACGCGATATGGATTC - 5 5'- ATATGCGCTATACCTAAG - 3 

  • 1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2....

    1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2. As a result of mutation, DNA sequence 5' A-G-A-T-G-A-C-T-G-A-A-G-T-C 3' changed into 5' A-G-A-T-G-A-C-T-G-A-G-T-C 3'. Which type of mutation is this? 3. What is the result of the following reaction" Fructose-6-phosphate + ATP (phosphofructokinase) -------> ? 4. Which steps of glycolysis are irreversible and used for its regulation (just step numbers are okay)? 5. What are the products of one turn of the citric...

  • Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...

    Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.

  • Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence...

    Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence of the mRNA that would result from transcribing the gene pictured would be A. AUGCGAUUA B. AUUAGCGUA C. UACGCUAAU D. UAAUCGCAU E. ATGCGATTA 3. The sequence of the peptide that would result from transcribing and translating the gene pictured would be A. Tyr-Ala-aso B. Ile-Ser-Val. C. no peptide would be made, the first codon means "stop." D. Met-are-Leu. E. Tyr-Ser-Val.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT