Question

Use the DNA sequence below and the genetic code in your text to answer the following...

Use the DNA sequence below and the genetic code in your text to answer the following questions.

Template DNA 3ʹ T A A G C G A T A C G A G A 5ʹ

Non-template DNA 5ʹ A T T C G C T A T G C T C T 3ʹ

What is the RNA sequence that would be transcribed from the sequence above? Include the 3ʹ and 5ʹ ends. (0.5)

b) What is the amino acid sequence that would be translated from the RNA sequence? (0.5)

c) Add one C nucleotide at the position indicated by the arrow. Rewrite the new DNA molecule, with the additional base pair, and include the 3ʹ and 5ʹ ends. (0.5) d) What is the RNA sequence (include the 3ʹ and 5ʹ ends) and the amino acid sequence that would be derived from the DNA sequence in question (c)?

e) What type(s) of mutation(s) is/are observed? (0.5)

f) Describe in some detail 3 different outcomes of this type of mutation and the potential impact on the organism from the smallest change to the largest change. Be quite specific about what happens to the protein in each case. (3)

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Use the DNA sequence below and the genetic code in your text to answer the following...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...

    Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

    In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

  • 9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what...

    9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what will the RNA codon be? What amino acid and/or function does this RNA codon code for? What RNA codon(s) code for the amino acid arginine (ARG)? What RNA codon codes for tryptophan (TRP)? What was the DNA sequence that was transcribed to make this codon? (backwards transcribe it) If the last nucleotide (letter) in the TRP codon changes to a "U," will the amino...

  • Answer please? The sequence below represents a middle section of the template strand of DNA of...

    Answer please? The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...

  • Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

    Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • The sequence below represents a middle section of the template strand of DNA of a structural...

    The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...

  • DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...

    DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT