Homework Answers
a) this mutation is due to the insertion of C before, after or in between 9-10 bases ( since both 9 and 10 th bases are C we cannot exactly pinpoint where insertion happened) due to the insertion reading frame of the gene is changed so this is frameshift mutation.
b) here it is asked to write codon of the in the translated portion of mRNA, the First codon which is translated is AUG which codes for methionine
so for normal gene mRNA (the region which is translated is the region between the start codon and stop codon)
5`- AUG CCG UAC UGC CAG CUA ACU GCU AAA GAA CAA UUA-3`
mutant gene
5`- AUG CCC GUA CUG CCA GCU AAC UGC UAA-3`
c) normal-
N- Met- Pro- Tyr-Cys-Gln-Leu-Thr- Ala-Lys-Glu-Gln-Leu
mutant- N- Met-Pro-Val-Leu-Pro-Ala-Asn-Cys-C
Add Answer to:
Im confused with the answer for B. Where did the AUG come
from?
13.31 Mutations in...
28. What is the amino acid sequence that will be produced from this original DNA sequence:...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
A mutation causing an addition or a deletion of one base pair resulted in the production...
A mutation causing an addition or a deletion of one base pair resulted in the production of a nonfunctional mutant protein. The sequences of the normal and mutant proteins are given below. Normal: Met - Leu - Ala - Thr - Gln Mutant: Met - Leu - Ala - His - Pro - Ile - Glu - Ser - Thr - Was this mutation cause by an insertion or a deletion? Answer Below, fill in the codons in the coding...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is...
A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is NH2-Leu-Met-Pro-Tyr-Ser-Ala-Ala-Pro-Cys-Leu-Trp-Glu-Ala-Gly-Asp-Arg-COOH. To verify and clone the gene encoding this protein from this uncharacterized bacterium, a student has to purify the bacterial genomic DNA and use it as the template to isolate the DNA fragment that encodes this peptide using PCR. The student plans to design a pair of oligonucleotides as the forward and reverse primers to PCR the DNA fragment that encodes this peptide....
Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are...
Did I answer the mRNA sequences
and Amino acid sequences correctly? What types of mutations are
these? How do you do the bottom?
Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off some amino acids). The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation - is...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off some amino acids). The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation - is...
i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded?...
i think there are two right answers?
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Did I answer the mRNA sequences
and Amino acid sequences correctly? What types of mutations are
these? How do you do the bottom?
Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
i think there are two right answers?
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago