Question
Im confused with the answer for B. Where did the AUG come from?
13.31 Mutations in the genes encoding the a and B subunits of hemoglobin lead to blood diseases such as thalassemias and sick
0 0
Add a comment Improve this question Transcribed image text
Answer #1

a) this mutation is due to the insertion of C before, after or in between 9-10 bases ( since both 9 and 10 th bases are C we cannot exactly pinpoint where insertion happened) due to the insertion reading frame of the gene is changed so this is frameshift mutation.

b) here it is asked to write codon of the in the translated portion of mRNA, the First codon which is translated is AUG which codes for methionine

so for normal gene mRNA (the region which is translated is the region between the start codon and stop codon)

5`- AUG CCG UAC UGC CAG CUA ACU GCU AAA GAA CAA UUA-3`

mutant gene

5`- AUG CCC GUA CUG CCA GCU AAC UGC UAA-3`

c) normal-

N- Met- Pro- Tyr-Cys-Gln-Leu-Thr- Ala-Lys-Glu-Gln-Leu

mutant- N- Met-Pro-Val-Leu-Pro-Ala-Asn-Cys-C

Add a comment
Know the answer?
Add Answer to:
Im confused with the answer for B. Where did the AUG come from? 13.31 Mutations in...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 28. What is the amino acid sequence that will be produced from this original DNA sequence:...

    28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat

  • Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....

    Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off a some amino acids).  The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation -...

  • A mutation causing an addition or a deletion of one base pair resulted in the production...

    A mutation causing an addition or a deletion of one base pair resulted in the production of a nonfunctional mutant protein. The sequences of the normal and mutant proteins are given below. Normal: Met - Leu - Ala - Thr - Gln Mutant: Met - Leu - Ala - His - Pro - Ile - Glu - Ser - Thr - Was this mutation cause by an insertion or a deletion? Answer Below, fill in the codons in the coding...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is...

    A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is NH2-Leu-Met-Pro-Tyr-Ser-Ala-Ala-Pro-Cys-Leu-Trp-Glu-Ala-Gly-Asp-Arg-COOH. To verify and clone the gene encoding this protein from this uncharacterized bacterium, a student has to purify the bacterial genomic DNA and use it as the template to isolate the DNA fragment that encodes this peptide using PCR. The student plans to design a pair of oligonucleotides as the forward and reverse primers to PCR the DNA fragment that encodes this peptide....

  • Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are...

    Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are these? How do you do the bottom?   Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....

    Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off some amino acids).  The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation - is...

  • Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....

    Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off some amino acids).  The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation - is...

  • i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded?...

    i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT