Given sequence
3’- AATTAGCGATATGTACGCTACCGTACGATTAA-5’
Replication of gene
3’- AATTAGCGATATGTACGCTACCGTACGATTAA-5’
5’- TTAATCGCTATACATGCGATGGCATGCTAATT-3’
Transcription
5’- TTAATCGCTATACATGCGATGGCATGCTAATT-3’
3’- AA UUA GCG AUA UGU ACG CUA CCG UAC GAU UAA-5’
Translation :- N- Asn-stop-C(no further addition of amino acid
In replication DNA make its copy both , daughter and parent strands are complementary and antiparallel to each other, where A bind to T and C to G or vice versa.
In transcription mRNA is form from DNA template strand. RNA polymerase bond to DNA template from 3’ site and produce mRNA from 5’ to 3’ direction, in mRNA T is replace with U.
In translation mRNA is polypeptide chain is produce from mRNA by using genetic information carry on mRNA
Translation takes place in N to C terminal of amino acid chain i.e. upcoming amino acid is bind to C terminal of existing amino acid
Please replicate the gene. Then transcribe and translate the sister strand of DNA. Remember to label...
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below using the single letter amino acid abbreviation. 3'TATAAATGCTCTACAGTTACTAAAATCTTATTTGAC5'
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...
9. Transcribe the top strand of this DNA into RNA. Label the 3' and 5' ends. DNA: 3' TAC CCC GGG AAA TTT ACT 5' 5' ATG GGG CCC TTT AAA TGA 3' S'AnGGGG CCc nUM AAA UGA? 10. Now translate your mRNA into Protein. Label the C-term and N-term.
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
help me answer these-
One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with the red one) b. Transcribe the replicated mutated strand to mRNA c. Translate the mRNA produced above to an amino acid sequence: d. What kind of mutation is this?