Question

QUESTION 23 In this figure, the numbers 1-6 represent reactants/products, and the letters A-E represent enzymes for the react

QUESTION 26 U с А G UGUcys UAC/Tyr UUG}Leu CAU His CGC UUU Phe UCU UAU UUC UCC UGC UUA UCA Ser UAA Stop UGA Stop A Leu UCG) U

0 0
Add a comment Improve this question Transcribed image text
Answer #1

represent fatty acide Ans (23) The Correct answer for this question is — d> The position of the last double bonel is betweenAns. 23) The correct answer for this question is- ay gt is most efficient for product 6 to inhibit enzyme A. xiplomation Bis

Add a comment
Know the answer?
Add Answer to:
QUESTION 23 In this figure, the numbers 1-6 represent reactants/products, and the letters A-E represent enzymes...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • 5' or or Using the codon table provided, fill in the missing entries in the following...

    5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...

  • 5 pts Question 33 The following prokaryotic DNA (same as above) is transcribed into RNA and...

    5 pts Question 33 The following prokaryotic DNA (same as above) is transcribed into RNA and the MRNA transcript is translated into protein. 31 21 11 1 ATGGGTTACT ATGAGGAGTT GACACACAAG AGGAGGTAGC 71 61 51 41 AGTATGGGTA TAATCTAATG CGTAATTGAG GAGGTAGTTG 101 111 91 81 ACGTATGCAT AGATAACGTA CGGGGGGGAA ACCCCCCCTT 141 131 121 TTTTTTTTTC GAGCAATAAA AGGGTTACAG Useful sequences: -35: 5' TTGACAT 3', -10: 5' TATAAT 3 (Pribnow box), Shine Dalgarno sequence: 5' AGGAGGU 3 THE GENETIC CODE THE GENETIC CODE SECOND LETTER A...

  • all of them please Question 12 (1 point) Which of the following conditions would kill amp'...

    all of them please Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...

  • 5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters...

    5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters in the alphabet to encode 20 amino acids. DNA on the planet Arth only contains A, G and C. In addition, proteins on Arth are made from 26 different amino acids. What is the minimum number of nucleotides in a codon needed to code for life on Arth? Hint: In humans a 3-letter code can represent 4 x 4 x4 = 64 amino acids...

  • can you answer those 3 questions Ipuints Save an You have developed a potential new antidepressant...

    can you answer those 3 questions Ipuints Save an You have developed a potential new antidepressant drug called Euphoria. The structure is novel and is tested using the Ames test for mutagenicity. The following results are obtained: Sample Number of his+ revertant colonies distilled water distilled water + rat liver enzymes antidepressant antidepressant + rat liver enzymes What conclusion is most consistent with these data? the drug and its conversion products are not mutagenic. rat liver enzymes are mutagenic. the...

  • 21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar...

    21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...

  • Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance!...

    Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance! (Q21-25) We have the following double-stranded DNA sequences, which codes for a 10 amino acid long protein gene. Use the codon table and answer the questions. 5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3' 3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5' 21. Which strand codes for this protein? A. top B. bottom C. both strands D. none of the above 22. If this is a eukaryotic gene, which RNA polymerase will make mRNA? A. RNA Pol I...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT