Question

21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenin

13. At which end of an mRNA molecule is the cap placed? 14. At which end of an mRNA molecule is the tail placed? 15. Consult

18. Why are some point mutations harmful and others are not? U UAC Tyr UGU7. UGC Cys mRNA Genetic Code с А UCU 7 UAU Tur UCC

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1 At 5'end of mRNA capping is made

2 the tail placed in 3' end of the mRNA

5' cap--------------------AAAAA 3'

Capping PolyA tail

3 the amino acid sequence for given mRNA is

Methionine-glycine -glutamic acid- Alanine

4 UGA is a stop codon which is used for stopping the protein synthesis. As the ribosomes reaches the stop codon the protein synthesis is stopped.

5 ccc-ccu, these two codons codes for the same amino acid proline. So there is no chang in amino acid.

Similarly uau-uac codes for tyrosine. So, there is no change in coded amino acid.

Cau-cgu causes change in amino acid. Cau codes for histidine and cgu codes for Arginine. Therefore the answer is yes with regard to change in amino acid.

6 point mutation are type of mutation caused by change in single nucleotide base. As seen in the above answer first two pair nucleotide codons change does not cause change in amino acid. So there is no change in protein sequence and function so it is not harmful. This kind of mutation is known as silent mutation since there is no notable effect.

Some mutation like in third example change in amino acid causes change in sequence and biological function. Change in function or loss of function results in harmful condition.

It may be nonsense mutation, if point mutation results in coding stop codon eg-UAC-UAA , misense mutation result in same amino acid of different codon. Eg:CAU-CGU

Add a comment
Know the answer?
Add Answer to:
21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...

    Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • 1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino...

    1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...

  • UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic...

    UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic Code for All 20 Amino Acids Second base -A- -G- UCU LAUT UGU UUC (phenylalanin UCCI UAC ) UGCysteine) UUA. serine UAA UUGI (cine) UGG Try tryptophan) CUU CGU CAC hidÌ CGC Ang CAA in CGA Carpinine) CAG plutamine) CGG AUU AAU 1 An AUC (isoleucine) AAC pengine AGC serie) AAA1 Lys AUG MOM AAG sind) AGGI arginine) GCU GAUl Asp GGU GUC Val...

  • 7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...

    7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT