HomeworkLib
Question

DNA is sequenced at

a.

step 2 only.
b.

step 1 only.
c.

steps 2 and 3.
d.

steps 1 and 2.
e.

step 3 only.Refer to the figure representing sequencing and analysis of microbial DNA. 2 AGCACGGACTTGTCACATACACATG 3
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Ans:

a. Only step 2 only

Explanation: DNA is isolated from the sample in the step 1. So, step 1 is DNA isolation step. The isolated DNA is sequenced in the step 2. So, step 2 is DNA sequencing step. In step 3, the sequenced DNA are compared to other known sequences. So, step 3 is data analysis step.

0 0
Add a comment
Know the answer?
Add Answer to:
DNA is sequenced at a. step 2 only. b. step 1 only. c. steps 2 and...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Question 17 Which statement about the globin genes in humans is false? a. The genes are...

    Question 17 Which statement about the globin genes in humans is false? a. The genes are also found in other mammals. b. All arose from a single common ancestor gene. c. All are expressed at the same time. d. Some different genes carry out different functions. e. They are an example of a gene family. Question 18 and Two-dimensional gel electrophoresis separates proteins based on a. size; shape b. shape; charge c. size; concentration d. size; charge e.concentration; shape Question...

  • In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a...

    In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a component of the reaction? A) fluorescently-labeled deoxynucleotides B) DNA polymerase C) a DNA primer D) the DNA to be sequenced E) none of the above (i.e. all the above are required in the reaction)

  • DNA excision repair A. involves only two distinct steps. B. requires visible light for activation. C....

    DNA excision repair A. involves only two distinct steps. B. requires visible light for activation. C. replaces both strands of a segment of DNA. D. is deficient in some human hereditary diseases. E. is blocked by allopurinol.

  • Q1) Innovations that make SMRT DNA sequencing possible are     . Group of answer choices A) Phospholinked...

    Q1) Innovations that make SMRT DNA sequencing possible are     . Group of answer choices A) Phospholinked nucleotides B) Single molecule sequencing C) ZMW D) Long read lengths E) All of the Above Q2) Why is it important to attach adaptors and amplify the DNA pieces on the glass slide before Illumina Sequencing by Synthesis? Group of answer choices A) To attach the DNA pieces to the glass slide. B)To distinguish DNA pieces from each other. C) To amplify each sequence...

  • Question 1.b of 12 A reaction mechanism has the following proposed elementary steps: Step 1: A...

    Question 1.b of 12 A reaction mechanism has the following proposed elementary steps: Step 1: A B +C Step 2: A+B →D Step 3: 2 A+D → C+E The overall reaction is 4 A 2 C + E. Which species are intermediates in this reaction? A) B and C B) B C) B and D D) D E) C and D

  • 1. There are three basic steps in DNA extraction - A. breaking open the cells, B....

    1. There are three basic steps in DNA extraction - A. breaking open the cells, B. removing lipids, proteins, and C. precipitating the DNA. In which step you use ethanol? (5) In which step you use phenol and chloroform? (5) In which step you use detergent? (5) 2. The tubes in the image contain lysed mouse liver tissue and phenol/choroform. Label the phases and explain in which phase you expect the DNA to be present. (10)

  • (blocked) d. PCR amplification of DNA fragments, cluster growth Below are some of the steps that...

    (blocked) d. PCR amplification of DNA fragments, cluster growth Below are some of the steps that occur in a Nextgen genomic sequencing reaction. Fill in the missing steps. Steps MUST be in the proper order. a. Isolate and fragment genomic DNA from an organism Ev [ Select ] Add primer/ fluorescent chain terminating nucleotides Bind to chip Assemble contig Remove chain terminator Read fluorescence Ligate linkers C e. (Select ] f. Wash away excess, non-bound chain terminating nucleotides [Select] h....

  • Put the following steps to creating a survey in order. - Step 1 - Step 2 A. Finalize the survey format B. Group questio...

    Put the following steps to creating a survey in order. - Step 1 - Step 2 A. Finalize the survey format B. Group questions around similar concepts C. Write questions in a simple and concise manner D. Proofread the survey several times • - - Step 3 Step 4 Step 5 E. Provide clear instructions for each transition in question type F. Pilot test the survey - Step 6 - Step 7 G. Pretest the survey H. In a written...

  • All of the following are DNA sequencing techniques except___. Select all that apply A) pyrosequecing B)...

    All of the following are DNA sequencing techniques except___. Select all that apply A) pyrosequecing B) mullis chain terminating sequencing c) sanger dideoxy sequencing d) DNA fingerprinting e) Illumina sequencing

  • 1. An HEXAPEPTIDE was sequenced using differing enzyme and chemical reagents. The results of these experiments,...

    1. An HEXAPEPTIDE was sequenced using differing enzyme and chemical reagents. The results of these experiments, along with an explanation of how to interpret the results, are provided below. Using this information, provide the 1˚ structure for this HEXAPEPTIDE. For the answer, be sure to include the following: A. Work/answers for Points B-F. B. The final sequence using 1 letter abbreviations for each amino acid. C. The structure of the final peptide drawn in MarvinSketch. Results from Sequencing Experiments on...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT