Question

Question 17 Which statement about the globin genes in humans is false? a. The genes are also found in other mammals. b. All a
Question 18 and Two-dimensional gel electrophoresis separates proteins based on a. size; shape b. shape; charge c. size; conc
Question 11 Refer to the figure representing sequencing and analysis of microbial DNA. 1 AGCACGGACTTGTCACATACACATG 3 Studies
0 0
Add a comment Improve this question Transcribed image text
Answer #1

17) Option d is the answer.

All different human globin proteins have same function.i.e binding to O2.

18)Option d is the answer. Size and Charge.

In 2D gel electrophorersis ,first it is separated based on it's pI(isoelectric point) i.e..on charge.

Then in the direction perpendicular to last one,it separates based on mass(size).

11)Option e is the answer.

We are analysing sample collected from environment.Here we are analysing some part of DNA.These are the steps what we follow in metagenomics.

Add a comment
Know the answer?
Add Answer to:
Question 17 Which statement about the globin genes in humans is false? a. The genes are...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration;...

    and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...

  • e. have several chromosomes. team of biologists collects samples from a stream. Using PCR and other...

    e. have several chromosomes. team of biologists collects samples from a stream. Using PCR and other techniques umerous DNA sequences. In doing so, they discover many new bacterial species working in the field of niques, they amplify . T a. metagenomics. b. junctional genomics. c.comparative genomics. d. relational genomics. e. proteomics. tarting with Mycoplasma genitalium, how was the minimal genome size of bacteria experimentally ssessed? a. By knocking genes out with transposons; if bacteria survived despite the gene being knocked...

  • In what way is artificial selection different from natural selection? Question 1 options: A.    There is no...

    In what way is artificial selection different from natural selection? Question 1 options: A.    There is no difference; both have caused evolution throughout the history of life on earth B.    Artificial selection applies to changes in domestic animals only, while natural selection applies to all other species C.    In artificial selection, human preference is the selecting force; in natural selection, environmental conditions are the selecting force. D.    Artificial selection causes one species to change to another, while natural selection only modifies existing species. E.    Artificial...

  • The smallest chemical units of matter are atoms b) molecules c) protons d) neutrons e) electrons...

    The smallest chemical units of matter are atoms b) molecules c) protons d) neutrons e) electrons . Which of the following would have the largest size? a) an atom b) a molecule c) a proton d) a neutron e) an electron 3. Isotopes of an element differ in the number of a) protons in the nucleus b) electrons in the nucleus © neutrons in the nucleus d) electron clouds e) energy levels they contain 4. VO The atomic number represents...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT