1- Correct- In some cases, two copies of a gene are required for normal function, so that removing a single copy leads to expression of mutant phenotype. Such genes are referred to as haplo-insufficient.
3. Correct -mutations in one allele may lead to a structural change in the protein that interferes with the function of the wild-type protein encoded by the other allele. These are referred to as dominant negative mutations.
Which of the following could lead a mutation to express a dominant phenotype? Check all that...
Which of the following could lead a mutation to express a dominant phenotype? Check all that apply. A) Both mutant and wildtype alleles are expressed in parallel in the phenotype B) The mutant protein interferes with the function of wildtype protein C) The affected gene is haploinsufficient D) The affected gene is haplosufficient
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Check all of the statements that apply to neomorphic alleles of genes Check All That Apply They are usually dominant to normal alleles. They are usually recessive to normal alleles. They can generate normal proteins. They can generate mutant proteins The HD-allele that makes a mutant protein with too large a polyQ region and thus causes Huntington disease is a good example. The mutation can be in either the promoter/enhancer or in the coding region The mutation can be in...
1. (2pts) Which of the following are features of heterochromatin (choose all that apply) Transcription ON Transcription OFF Increased histone acetylation Decreased histone acetylation Densely packed nucleosomes Loosely packed nucleosomes Increased DNA methylation Decreased DNA methylation Questions 2-3: The Igf2 gene encodes insulin-like growth factor 2, a protein that is important for normal growth. In mice, no expression of the Igf2 gene results in a growth deficiency and a small mouse phenotype. The Igf2 gene is maternally imprinted and autosomal....
Which event may lead to cancer? Select all that apply. A. gene mutation B. functioning p53 protein C.Rb protein phosphorylating D. Improper replication of DNA during synthesis E. faulty DNA repair Mark for Review What's This?
70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A primer c. A DNA template d. DNA Gyrase e. Deoxyribonucleotide triphosphate 86. Two phenotypically normal people have 4 children. 3 are phenotypically normal like their parents, but one is an albino. What are the probable genotypes of the parents? a. Both parents are homozygous dominant b. Both parents are homozygous recessive c. One parent is homozygous dominant and the other is homozygous recessive d....
Which of the following statements about mutations are true? Select all that apply. Select one or more: a. Both substitution and indel mutations could result in a non-sense mutation in the affected codon following the mutational event. b. Indel mutations that occurred in an exon (translated part of the gene) can be silent. c. A substitution mutation can lead to a frameshift. d. Mutations are the only source for the origin of new alleles. Consider the wild-type DNA sequence: 3'...
produce random mutations in the line with boundary element 1 deleted and see that in one of mutant lines, all of the cells are wild-type. Which of the following mutations could have caused this phenotype? Select all correct answers, there may be multiple. Establishment of a new boundary element in between the centromere and the spiky gene Loss of function mutation of HP1, which is a protein required for heterochromatin spreading Loss of function mutation of a histone acetyltransferase, which...
Describe what a conditional mutation is and why you would need
to create one. Using the cdcX, cdcY, cdcZ example from your
textbook, describe how complementation analysis was used to
determine which cdc mutations were in the same or in different
genes. Explain why this method would not work for dominant
mutations.
Complementation analysis determines whether recessive mutations are in the same or different genes. Mutant (type a) (cdcx) Mutant (type c) (cacy) Mutant Mutant (type a) (type c) cdccdcz...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...