Question

At a specific area of a chromosome, the sequence of nucleotides below is present where the...

At a specific area of a chromosome, the sequence of nucleotides below is present where the chain opened to form a replication fork:

3' C C T A G G C T G C A A T C C 5'

A 7-nucleotide RNA primer is formed starting at the underlined T (T) of the template. What is the primer sequence, including 5' and 3' end?

The "T" in bold is the underlined T.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

In DNA replication, DNA synthesis occurs in 5' to 3' direction . Lagging strand needs to be replicated in the opposite direction of the way the replication fork is proceeding. So in the lagging strand ,where the RNA polymerase synthesize a short RNA primer in 5' to 3' direction, which will be extended by DNA polymerase 111. Primer is RNA strand, so the adenine bases will be replaced with uracil. Later when the lagging strand formation is completed , the RNA primer will be replaced with deoxyribonucleotides by DNA polymerase I . DNA polymerase 1 removes RNA primers and fills the gaps between Okazaki fragments with DNA. DNA ligase then joins the okasaki fragments.

3' C C T A G G C T G C A A T C C 5' is the template strand in replication fork.

The primer will be,   5' A C G U U A G 3'

Add a comment
Know the answer?
Add Answer to:
At a specific area of a chromosome, the sequence of nucleotides below is present where the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • 3. A specific area of a chromosome has the following sequence of nucleotides. 3′- TGCAATCO.5′ During...

    3. A specific area of a chromosome has the following sequence of nucleotides. 3′- TGCAATCO.5′ During transcription, what would be the sequence of the RNA that would form due on this chromosome?

  • Question 10 A human chromosome has 3 origins of replication. Assuming that all 3 origins of...

    Question 10 A human chromosome has 3 origins of replication. Assuming that all 3 origins of replication are used at the same time, what is the maximum number of helicases present on DNA during DNA replication (not including DNA repair)? 12 O 3 O2 Question 11 Which of the following correctly compares primase and telomerase? O Both primase and telomerase synthesize DNA using a DNA template. O Primase synthesizes RNA using an RNA template, but telomerase synthesizes DNA using a...

  • ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin...

    ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin is 1,734 nucleotides in length and is located on the human chromosome 11. The mutation responsible for sickle-cell anemia affects a single nucleotide, which in turn changes a single amino acid. (9 pt) a. How are these nucleotides joined together to form a long polynucleotide chain? Name the relevant nucleotide constituents important for making the linkage. (see Slides 5-7 of Lecture 4b) (2 pt)...

  • *Microbiology. Please answer the below two multiple choice questions. The current selected answers are incorrect. Thank...

    *Microbiology. Please answer the below two multiple choice questions. The current selected answers are incorrect. Thank you, will provide positive feedback for correct answers! Incorrect Question 3 0/1 pts The replication fork has both leading (continuous) and lagging (discontinuous) synthesis because: a. The origin of replication only allows DNA synthesis to occur in one direction around the chromosome. b. Primase only works on the leading strand c. Helicase is slow in unwinding the double helix so the polymerization moving toward...

  • The specific catalytic activity of the telomerase enzymes is best described as: a. Adding extra nucleotides...

    The specific catalytic activity of the telomerase enzymes is best described as: a. Adding extra nucleotides to the 3' DNA overhang at the ends of each chromosome b. Adding extra nucleotides to both strands of DNA at the ends of chromosomes c. Removing 'junk' DNA from the ends of chromosomes d. Generating a new primer sequence on the very tip of the lagging strand after DNA replication e. Coordinating the binding of special telomere cap proteins that protect the ends...

  • .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A...

    .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...

  • 11. A gene is best defined as a. A segment of DNA b. Three nucleotides that...

    11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....

  • Given: TTGGGTTAGGGTTAGGGTTAGGA What is the probability that the specific sequence required to form a protein structure...

    Given: TTGGGTTAGGGTTAGGGTTAGGA What is the probability that the specific sequence required to form a protein structure occurs randomly in any given DNA? Assume that all four DNA nucleotide bases (A, T, C and G) are equally probable and nucleotides are present in excess.

  • 1. Match the molecule or term with its description Question Selected Match semi-conservative A. mechanism of...

    1. Match the molecule or term with its description Question Selected Match semi-conservative A. mechanism of replication for viral DNA theta B. mechanism of replication for circular bacterial DNA rolling circle C. mechanism of DNA replication determined by Meselson and Stahl OriC D. where the two new DNA strands are synthesized A-T rich region E. where DNA unravels when initiator proteins bind OriC replication fork F. where replication begins for the bacterial chromosome leading strand G. the new DNA strand...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT