Does mRNA editing requires double strand DNA breakage?
DNA editing is a method where modificatins in DNA are put forward to achieve new functions or product out of it. DNA editing methods or Genome editing methods are relied on initial break in double stranded DNA for furthur editing and modification of genome. So, yes double stranded breaks are important but now there are some techniques of DNA editing where there is no requirement for brekage of double stranded DNA instead this process goes with base replacement process. Modifications are done at base level and its irreversible in nature.
If it was helpful give a thumps up
5. About double strand DNA repair, it is correct to say that choose the most appropriate answer): (a) It requires one intact strand as a template for error correction. (b) Mismatches in the DNA are usually corrected via double strand DNA repair mechanisms. (c) Homologous recombination usually results in DNA repair with no loss of nucleotide at repair site. (d) Non-homologous end-joining usually results in DNA repair with no loss of nucleotide at repair site. 6. A eukaryote gene has two introns and three exons....
please help !
What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check Answer Use the codon table to answer the following questions: THE CODON TABLE SECOND POSITION FIRST POSITION THIRD POSITION 0000000000000000 What would be the second amino acid produced by the DNA strand TACCGA GTCACG (Hint: use the mRNA strand you already coded) Check Answer Value: 1 What would be the third amino acid produced by the DNA strand: TACCGAGTCACG (Hint: use the mRNA strand...
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand DNA template: 3' ------ 5' ______________ ______________ _____________ ____________ ____________ mRNA Strand: 5'------3' _____________ _____________ ____________ ____________ ______________
Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA that gave rise to this messenger RNA.
48) If one strand of a DNA double helix ha one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand? A) GACGTCA B) AGTACTGC) GTCATGAD) TCATGAC 49) A DNA molecule has the sequence AGTTCAACT. The equivalent RNA molecule would have the sequence AGTTCAACT B) AGUUCAACU C) UGTTCUUCT D) UGUUCUUCU 50) what group(s) in amino acid carboxyl and Amino D) Hydroxyl and Carboxyl B) carbonyl and Amino C) Hydroxyl and Carbonyl
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...