Question

If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

If the sequence of an mRNA molecule is:

5' AUG GGA UUU CGA 3'

(a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3' ends are located) (1.5 marks)

(b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3' ends are located) (1.5 marks)

(c) Give the amino acid sequence. (1.5 marks)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

a) Template strand DNA 3'TAC CCT AAA GCT 5'

b) Non-template strand DNA 5' ATG GGA TTT CGA 3'

c) AUG codes for methionine, GGA codes for glycine, UUU codes for phenylalanine and CGA codes for arginine. Hence the Amino acid sequence is MET-GLY-PHE-ARG

Add a comment
Know the answer?
Add Answer to:
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give...

    If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3' ends are located) b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3' ends are located) c) Give the amino acid sequence.

  • can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...

    can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • 1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...

    1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?

  • 15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would...

    15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'

  • S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG...

    S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT