Question

what base in mRna transcript would represent the DNA templete sequence ?

what base in mRna transcript would represent the DNA templete sequence ?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans : One strand of the DNA, the template strand (noncoding strand), is used as a template for RNA synthesis. Three of the four nitrogenous bases that make up RNA - Adenine (A), Cytosine (C), and Guanine (G) - are also found in DNA. In RNA, however, a base called uracil (U) replaces thymine (T) as the complementary nucleotide to adenine. This means that during elongation, the presence of adenine in the DNA template strand tells RNA polymerase to attach a uracil in the corresponding area of the growing RNA strand.

Add a comment
Know the answer?
Add Answer to:
what base in mRna transcript would represent the DNA templete sequence ?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a...

    Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:

  • The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is...

    The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG -3' What is the sequence of the DNA template strand? 5'- || -3' BI U x2 x2

  • From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'

    From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'

  • The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence,...

    The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5' and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3

  • mRNA Transcript and Features: 4 In sequence (b) below, use your mouse to click and mark...

    mRNA Transcript and Features: 4 In sequence (b) below, use your mouse to click and mark the mid-point of the Shine-Dalgarno sequence. Shown below are: (a) the 5' sequence of an mRNA transcript of an E. coli gene, and (b) the DNA coding strand with the sequence of the promoter and beginning of the coding sequence of the gene. (a) ACAUCCUAGGAGGAUUACCCAUGCGGU... (b) ...GGCTTGACATACCGATGGTTCAA CTGGATATAATGTAGCTCACATCCTAGGAGGATTACCCATGCGGTCC...

  • Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA...

    Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...

  • 1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the...

    1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5’and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3' B. Hydrolysis reactions They do so by link monomers to form a polymer; adding a water molecule remove monomers from...

  • If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of...

    If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'

  • i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...

    i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.

  • A strand of DNA has the base sequence GATTCA

    3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT