Question

Refer to the table. Biologists knock out the function of several genes in a bacterium, then examine whether the bacterium can
All cells in a mouse are genetically identical, yet many cells like brain or liver cells perform specialized functions. How d
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1) option e) D,F and G

Expalnation: According to above table, it can be seen that in case of gene (A,B), (B,C) and E bacteria has grown whereas in cases (A,D) , F, and (A,G) bacteria didn't grow which reflect that gene D,F,G are important for its growth as gene A is already shown to have no effect on growth of bacteria. So, minimal genome can be consist of these three (D,F,G).

2) a) Through transcription factor activity

Explanation: It is transcription factor that controls expression of genes in cells. Expression of particular gene in a specific cell type leads to give specific proteomics which give out specialised function to that cell. So, yes , transcription factors are main hands to drive cell differentiation.

If it was helpful, give a thumps up

Add a comment
Know the answer?
Add Answer to:
Refer to the table. Biologists knock out the function of several genes in a bacterium, then...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • All cells in a mouse are genetically identical, yet many cells like brain or liver cells...

    All cells in a mouse are genetically identical, yet many cells like brain or liver cells perform specialized functions. How do these cells achieve this level of specialization? a. Through transcription factor activity b. Through alternative splicing of mRNA c. Through the accumulation of mutations d. Through gene silencing e. Through post-translational modifications Which material would not be required for determining the sequence of a 400 bp DNA fragment by the high-throughput sequencing method? a. A short, artificially synthesized primer...

  • A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...

    A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...

  • e. have several chromosomes. team of biologists collects samples from a stream. Using PCR and other...

    e. have several chromosomes. team of biologists collects samples from a stream. Using PCR and other techniques umerous DNA sequences. In doing so, they discover many new bacterial species working in the field of niques, they amplify . T a. metagenomics. b. junctional genomics. c.comparative genomics. d. relational genomics. e. proteomics. tarting with Mycoplasma genitalium, how was the minimal genome size of bacteria experimentally ssessed? a. By knocking genes out with transposons; if bacteria survived despite the gene being knocked...

  • Which of the following forms of mutagenesis is not appropriate for a forward genetics experiment? a)...

    Which of the following forms of mutagenesis is not appropriate for a forward genetics experiment? a) Ionizing radiation such as X-rays b) Creating a chimeric reporter gene to determine where in the organism a candidate regulatory sequence drives expression. c) Using transposons d) Chemical EMS mutagenesis In the course of evolution, the most common source of new genes in eukaryotes has been? a) Robertsonian translocation b) DNA duplication c) Alternative splicing d) Reverse translation e) Whole genome duplication Genes that...

  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

  • 1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteina...

    1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...

  • QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into...

    QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into a tool for biotechnology? a. It could possibly be turned into a viral vector against lung cancers b. Its promoters might be used to express genes in lung cells c. Its surface proteins could be used for new epitope tags d. All of the above QUESTION 2 Which of the following are applications of molecular assembly described in this course? a. It can be...

  • can u tell me if these answers are correct please!??!!! Choose the best answer for the...

    can u tell me if these answers are correct please!??!!! Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...

  • DATE: NURS 208A NAME: 1. The function of ribosomes is to: 6. Inb Digest foreign bacteria...

    DATE: NURS 208A NAME: 1. The function of ribosomes is to: 6. Inb Digest foreign bacteria and toxic substances Produces energy from glucose y Aid in cell division Synthesize proteins Which of the following statement is false about the cell membrane? 2. Cell membrane is composed of phospholipid layer The cell membrane prefers large molecules to pass through freely Cell membrane is a semipermeable boundary which determines what can enter and ex the cell The exterior surface is hydrophilic phosphate...

  • Please summarise the following content:(no word limit) EXPERIMENTAL PROCEDURES Animals All animals including pregnant ICR mice,...

    Please summarise the following content:(no word limit) EXPERIMENTAL PROCEDURES Animals All animals including pregnant ICR mice, neonatal Wistar rats, and NOD-SCID mice (8 weeks old, male) were purchased from CLEA Japan (Tokyo). All exper- imental procedures and protocols were approved by the Animal Care and Use Committee of Keio University and conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Cells Mouse ESCs were obtained from the Laboratory of Pluripotent Cell Studies, RIKEN...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT