Question

Explain in detail what happens to the protein when there is a deletion in the DNA for a gene that codes for a chloride channe
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The most common genetic abnormality causing cystic fibrosis involves the deletion of just three DNA bases from the CFTR gene. Cystic fibrosis is a recessive genetic disease which means that both copies of a person's CFTR gene must contain the mutation for cystic fibrosis to occur. The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane conductance regulator. This protein channel normally transports chloride ions in and out of these cells which helps control the movement of water in tissues, ensuring that the mucus in the airways and various body systems remains thin and free-flowing. This protein acts as a channel across the membrane of cells that are specialised to produce mucus, sweat, saliva, tears and digestive enzymes.

The most common mutation, called delta F508, is a deletion of one amino acid at position 508 in the CFTR protein. The resulting abnormal channel breaks down shortly after it is made, so it never reaches the cell membrane to transport chloride ions. This means mucus-producing cells secrete mucus that is abnormally thick and sticky resulting in the symptoms of cystic fibrosis.

Add a comment
Know the answer?
Add Answer to:
Explain in detail what happens to the protein when there is a deletion in the DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • For regulation of the trp operon, what happens to in the absence of tryptophan? repressor protein...

    For regulation of the trp operon, what happens to in the absence of tryptophan? repressor protein (a) It binds to the operator, and represses transcription of genes in the trp operon (b) It cannot bind to the operator, and transcription of genes in the trp operon takes place (c) It binds to the regulatory gene that codes for the TrpR repressor, and represses its transcription (d) It cannot bind to the regulatory gene that codes for the TrpR repressor, and...

  • DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication

    Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • 82 GENETICS LABORATORY MANUAL 4. Cystic fibrosis is one of the most common autosomal recessive diseases...

    82 GENETICS LABORATORY MANUAL 4. Cystic fibrosis is one of the most common autosomal recessive diseases in people Northern European descent. A mutation in the CF gene affects a protein involved in the transport of chloride and sodium across cell membranes, causing thick mucus and secretions, lung damage, and nutritional deficiencies. The disease is inherited in an autosomal recessive manner, meaning one must inherit two mutated alleles in order to have the disease. Greg does not have cystic fibrosis, and...

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • 1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no...

    1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no introns in the coding sequence. Based on what you know about transcription, translation, and cellular trafficking, where would you expect the protein encoded by this gene to localize? Explain your reasoning. ATGATGTCATTCGTATCCCTGCTACTAGTGGGCATTCTGTTCTGGGCGACCGAGGCGGAA CAGCTGACCAAATGCGAAGTGTTTCAGATGGTCTCAAAGGGTGAAGAAGCTGAAGGGCGG CACTCGACAGGTGGCATGGATGAATTGTATAAGAAGGACGAGCTCTAA 2. If you were to mutate the abovementioned gene to disrupt localization of the encoded protein, what mutation(s) would you introduce? Where would you expect the protein to now localize?

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • 1. Describe in as much detail as possible DNA replication OR protein translation. Use the proper...

    1. Describe in as much detail as possible DNA replication OR protein translation. Use the proper terms for the enzymes (proteins) involved. 2. Define: mutations, spontaneous mutations, induced mutations. 3. Compare the design of negative selection and positive selection plating to the identification of bacterial mutants. 4. How is Ti plasmid used in rDNA 5. Describe the structural characteristics of plasmids and explain the roles they play in microbial cells.

  • 8) A pt. has severe mental retardaction caused by a deletion of a chromosome B. What...

    8) A pt. has severe mental retardaction caused by a deletion of a chromosome B. What genetic disorder will the nurse see documented in the hart a. Prader-Willi syndrome c. Cridu chat Syndrome b. Downs do trisomy x qy the nurse is teaching staff about the most common cause of Downs, what is the nurse describing ? - Paternal non disjunction - maternal rondisjunction - Maternal translocations - paternal translocation 10). A couple has 3 offspring: a child w/ an...

  • A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication...

    A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication fork, DNA polymerase III, primase, and ligation. Make sure that your answer is complete and that all the entities that come together in the process of lagging strand replication are clearly explained. Draw one figure of a replication fork with the polarity (directionality) of each DNA strand indicated. G) Explain RNA transcription in E. coli in detail, from initiation to termination. Underline the following...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT