Question

1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no...

1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no introns in the coding sequence. Based on what you know about transcription, translation, and cellular trafficking, where would you expect the protein encoded by this gene to localize? Explain your reasoning.

ATGATGTCATTCGTATCCCTGCTACTAGTGGGCATTCTGTTCTGGGCGACCGAGGCGGAA CAGCTGACCAAATGCGAAGTGTTTCAGATGGTCTCAAAGGGTGAAGAAGCTGAAGGGCGG CACTCGACAGGTGGCATGGATGAATTGTATAAGAAGGACGAGCTCTAA

2. If you were to mutate the abovementioned gene to disrupt localization of the encoded protein, what mutation(s) would you introduce? Where would you expect the protein to now localize?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

DNA Sequence:

AUGAUGUCAUUCGUAUCCCUGCUACUAGUGGGCAUUCUGUUCUGGGCGACCGAGGCGGAA CAGCUGACCAAAUGCGAAGUGUUUCAGAUGGUCUCAAAGGGUGAAGAAGCUGAAGGGCGG CACUCGACAGGUGGCAUGGAUGAAUUGUAUAAGAAGGACGAGCUCUAA

mRNA Sequence:

AUGAUGUCAUUCGUAUCCCUGCUACUAGUGGGCAUUCUGUUCUGGGCGACCGAGGCGGAA CAGCUGACCAAAUGCGAAGUGUUUCAGAUGGUCUCAAAGGGUGAAGAAGCUGAAGGGCGG CACUCGACAGGUGGCAUGGAUGAAUUGUAUAAGAAGGACGAGCUCUAA

Protein Sequence:

M M S F V S L L L V G I L F W A T E A E Q L T K C E V F Q M V S K G E E A E G R H S T G G M D E L Y K K D E L Stop

It is targeted to Endoplasmic reticulum (ER) lumen as it has the L L L V G I L F W A sequence which is required for import into the ER and the KDEL sequence at the C terminus, which is required for retention into ER lumen.

2. If the KDEL amino acids are mutated, the protein will be pass through the ER but is not retained. It will now be secreted. Mutations can be induced which replaces any of the KDEL amino acids with unrelated amino acid. However, no stop codon should be created prematurely.

Add a comment
Know the answer?
Add Answer to:
1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain...

    A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain of 200 amino acids of MET-ARG-GLY-(196 more amino acids)-ASN after splicing. A mutation occurs in which the third G is changed to a T. Using the genetic code below, determine which type of mutation this is and briefly explain how translation will be affected for this protein chain.

  • Match the protein listed below with the gene that encodes it or with the DNA sequence...

    Match the protein listed below with the gene that encodes it or with the DNA sequence within the lac operon where it binds: lac repressor (encoded by...) [Choose] lac repressor (where it binds...) [Choose ] B-galactosidase [Choose] Lactose permease [Choose] Galactoside transacetylase [Choose] CAP [Choose] lacz lacy lacl Operator CAP site lacA

  • You are given the following sequence of DNA which encodes for a short protein (this is...

    You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • 2. The following sequence is a wild-type gene that encodes a tRNA-his molecule that recognizes the...

    2. The following sequence is a wild-type gene that encodes a tRNA-his molecule that recognizes the codon 5- CAU-3' on all mRNAs in the bacterial cell. The sequence given is from the point where transcription starts (called "+1") to the point where transcription ends (called the "terminator"). 5'-CCCGTTGCTCAGATCTGGATATCCTTCCTGCATAGAATCGCTTGCTGAAGCTGATACGCGCAACGGT-3' 3'-GGGCAACGAGTCTAGACCTATAGGAAGGACGTATCTTAGCGAACGACTTCGACTATGCGCGTTGCCA-5' a. Which strand (the upper or the lower) is used as the template in transcription? UNDERLINE THE CORRECT CHOICE b. Write out the amino acid sequence the protein, if any, that...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

  • The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the...

    The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the mRNA sequence of this stretch of DNA. (how it would read if this gene would be transcribed) #2 Write the protein sequence in single letter code that corresponds to the mRNA sequence.

  • Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...

    Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...

  • A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It...

    A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. i atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggato aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the PBR322 plasmid (shown below). You must use the Pstl and EcoRI sites for your cloning. HindIII EcoRI | EcoRV BamHI 4359 0 29 185 4000 375 Sall Psti...

  • The DNA sequence shown encodes the last amino acids of a protein that has a total...

    The DNA sequence shown encodes the last amino acids of a protein that has a total of 270 amino acids. The bolded base pairs indicate the translation reading frame. 5’ …….GCT AAG TAT TGC TCA AGA TTA GGA TGA TAA ATA ACT TGG 3’ 3’ …….CGA TTA ATA ACG AGT TCT AAT CCT ACT ATT TAT TGA ACC 5’ Which is the template strand for transcription? Explain.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT