Question

A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain...

A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain of 200 amino acids of MET-ARG-GLY-(196 more amino acids)-ASN after splicing. A mutation occurs in which the third G is changed to a T. Using the genetic code below, determine which type of mutation this is and briefly explain how translation will be affected for this protein chain.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

As the mutation occurs in G, a purine to T,a pyrimidine- it is a transversion type of point mutation.

In the DNA sequence - ATGCGTGGA-, the mRNA having -AUG- codon in first,codes for the amino acid Methionine,which is the START CODON. So when this codon is present,the translation will start. But when the third G is mutated to T; the mRNA will have the codon sequence -AUU-, which codes for Isoleucine. So, from there the translation will not start.

Add a comment
Know the answer?
Add Answer to:
A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Suppose part of the amino acid sequence of a protein is N... Gly - Ala -...

    Suppose part of the amino acid sequence of a protein is N... Gly - Ala - Pro - Arg - Lys ...C. Which of the following amino acid sequences could result from a frameshift mutation (+1 or -1) in the part of the gene that encodes this sequence of amino acids? Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...

  • You have a small gene that encodes the following amino acid: N-MET-ASP-SER-VAL-ALA-ARG-PHE-MET-TRP-C. There is a single...

    You have a small gene that encodes the following amino acid: N-MET-ASP-SER-VAL-ALA-ARG-PHE-MET-TRP-C. There is a single mutation in the DNA that causes a change in the amino acid sequence to: N-MET-VAL-GLN-TRP-PRO-ASP-LEU-CYS-GLY-C. a) What kind of mutation is this? Explain. (2 points) b) Indicate the DNA sequence (coding strand) of the gene. Show the original DNA sequence then the mutated sequence. Wild type DNA: Mutant DNA: You have another mutation (a different mutation from the one described in parts a and...

  • 1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no...

    1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no introns in the coding sequence. Based on what you know about transcription, translation, and cellular trafficking, where would you expect the protein encoded by this gene to localize? Explain your reasoning. ATGATGTCATTCGTATCCCTGCTACTAGTGGGCATTCTGTTCTGGGCGACCGAGGCGGAA CAGCTGACCAAATGCGAAGTGTTTCAGATGGTCTCAAAGGGTGAAGAAGCTGAAGGGCGG CACTCGACAGGTGGCATGGATGAATTGTATAAGAAGGACGAGCTCTAA 2. If you were to mutate the abovementioned gene to disrupt localization of the encoded protein, what mutation(s) would you introduce? Where would you expect the protein to now localize?

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a...

    The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a membrane glycoprotein of T lymphocytes. 5’ACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGG3’ 1. Produce the corresponding RNA fragment. 2. Produce the partial primary protein sequence (one letter codes for amino acids) using reading frame 3.

  • The human protein coding gene frt has three exons. A mutation at the splice junction between...

    The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: termination of translation within the coding sequence of the second exon termination of transcription within the coding sequence of the second intron termination of transcription before the coding sequence of the second exon termination...

  • The human protein coding gene frt has three exons. A mutation at the splice junction between...

    The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: O termination of transcription within the coding sequence of the second intron O termination of transcription before the coding sequence of the second exon termination of translation within the coding sequence of the second...

  • Example question (p. 171). The amino acid sequence of a wild-type protein is Met-His-Ala-Trp-Asn-Gly-Glu–His-Arg The amino...

    Example question (p. 171). The amino acid sequence of a wild-type protein is Met-His-Ala-Trp-Asn-Gly-Glu–His-Arg The amino acid sequences of two mutants are: Mutant 1: Met-His-Ala-Trp-Lys-Gly-Glu–His-Arg Mutant 2: Met-His-Ala For each mutant, specify the type of mutation that has occurred, using the mutation classification system based on effect to protein function

  • The substitution of a T for an A in the protein coding sequence of the globin...

    The substitution of a T for an A in the protein coding sequence of the globin gene introduced a SNP. This SNP changed an amino acid resulting in sickle cell anemia. Unaffected individuals have the DNA sequence GAGGAG, a BseRI restriction enzyme site, in their gene generating two DNA fragments of 2 and 4 kb. The A to T substitution occurs within the BseR1 site thus inactivating the site (GTGGAG). Draw the RFLP gel including results for a carrier, as...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT