Question

The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the...

The following DNA sequence encodes the beginning of the protein

5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’


#1 Write the mRNA sequence of this stretch of DNA. (how it would read if this gene would be transcribed)

#2 Write the protein sequence in single letter code that corresponds to the mRNA sequence.


0 0
Add a comment Improve this question Transcribed image text
Answer #1

5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’

3’UACGAUCGGGAUCGACUAUUGUAAGAUGCAUAUUAUUUAAAGGAU 5’

This is the mRNA sequence that is obtained from the given sequence. The sequence will be read from 5’ to 3’ direction.

5’UAGGAAAUUUAUUAUACGUAGAAUGUUAUCAGCUAGGGCUAGCAU3’

                         STOP-E-I-Y-Y-T-STOP-N-V-I-S-STOP-G-STOP-H

The protein encoded from the mRNA read from 5’ to 3’ direction is given here.

Add a comment
Know the answer?
Add Answer to:
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are given the following sequence of DNA which encodes for a short protein (this is...

    You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...

  • I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

    I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...

  • The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...

    The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...

  • 1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no...

    1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no introns in the coding sequence. Based on what you know about transcription, translation, and cellular trafficking, where would you expect the protein encoded by this gene to localize? Explain your reasoning. ATGATGTCATTCGTATCCCTGCTACTAGTGGGCATTCTGTTCTGGGCGACCGAGGCGGAA CAGCTGACCAAATGCGAAGTGTTTCAGATGGTCTCAAAGGGTGAAGAAGCTGAAGGGCGG CACTCGACAGGTGGCATGGATGAATTGTATAAGAAGGACGAGCTCTAA 2. If you were to mutate the abovementioned gene to disrupt localization of the encoded protein, what mutation(s) would you introduce? Where would you expect the protein to now localize?

  • 1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...

    1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?

  • The following is a small stretch of DNA sequence from middle of a bacterial open reading...

    The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length :      5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’      3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’ A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)? B) What is the basis for your answer to part...

  • 4. The following is a small stretch of DNA sequence from middle of a bacterial open...

    4. The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length: 5 «асстлcтстAтстттАСАТcтaтacтлсос - 3 3-CGGATGAGATACAAATGTAGACACGATGCG - 5' A. Which of the strands is the template strand for the mRNA that is transcribed from this DNA ("top strand" 5' 3' left to right or "bottom strand' 5 3 ' right to left)? B. What is the basis for your answer to part...

  • Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...

    Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...

  • A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain...

    A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain of 200 amino acids of MET-ARG-GLY-(196 more amino acids)-ASN after splicing. A mutation occurs in which the third G is changed to a T. Using the genetic code below, determine which type of mutation this is and briefly explain how translation will be affected for this protein chain.

  • 6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...

    6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT