Write the sequence of the peptide in single letter abbreviation.
Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
Write the sequence of the peptide in single letter
abbreviation.
н SH н н N н...
Write the sequence of the peptide in single letter abbreviation. он н H н N н...
Write the sequence of the peptide in single letter
abbreviation.
он н H н N н он н N н НО. HN HAN NH2
Write the sequence (single letter abbreviation) of the peptide (6 Points) H N SH H ZI...
Write the sequence (single letter abbreviation) of the peptide (6 Points) H N SH H ZI N H H
6. A peptide has the sequence Cys-His-Phe-Glu-Ala-Arg a. Write the single letter sequence of the peptide...
6. A peptide has the sequence Cys-His-Phe-Glu-Ala-Arg a. Write the single letter sequence of the peptide b. Calculate the percentage and indicate the charge of the predominant peptide species at pH 6.5. Use the following pKa values: pKa Cys = 8.3, pKa N-terminus = 10.8, pKa His =6.0, pKa Glu = 4.3, pKa Arg = 12.5, pKa C-terminus =2.0 c. What is the charge of the peptide at pH 4.3? d. Draw the chemical structure of the predominant peptide species...
Draw the condensed structural formula for the peptide methionylaspartic acid. Give its three letter and single...
Draw the condensed structural formula for the peptide methionylaspartic acid. Give its three letter and single letter abbreviation. Highlight (draw it real dark) the peptide bond in it.
please answer thoroughly and correctly thjs js my last try Vasopressin is a peptide hormone synthesized...
please answer thoroughly and correctly thjs js my last try
Vasopressin is a peptide hormone synthesized by the hypothalamus; in its reduced form it has the structure shown. NH2 HS H H₂N н NH2 SH H NH2 OH Vasopressin NH *H N NH2 This structure is incorrect in that one of the amino acids is shown in the D-configuration, rather than the L. Which one is it? What is the amino acid sequence of this peptide? CYFONCPRG Enter your answer...
16) Below is a tripeptide. A) Using arrows, identify the two peptide bonds. (2 pts) SH...
16) Below is a tripeptide. A) Using arrows, identify the two peptide bonds. (2 pts) SH H₂N OH Ноо Glutamic acid Cysteine Glycine B) Give the amino acid sequence using the amino acid three letter abbreviations for the tripeptide. (2 pts)
-HAPTER 4 CLAUOVOR " Tyrosine O Asparticauid Ho iX !! HOH Peptide Bond Alanie Y qoo...
-HAPTER 4 CLAUOVOR " Tyrosine O Asparticauid Ho iX !! HOH Peptide Bond Alanie Y qoo Guysine Сн, / сн. н сH, Hн fan-e--c-coo- alpha HH OH OH H Carbon How many amino acid residues are in this structure? 48 amino acid residles How many peptide bonds are in this structure? 3 Peptide bonds What is the name of the C terminal residue? Gusine What is the one-letter abbreviation of the N-terminal residue? What is the sequence, given in three-letter...
help with these please Examine the peptide. Thr-Glu-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys Write the sequence using one-letter abbreviations. sequence: TKPIVAPMEYGK...
help with these please
Examine the peptide. Thr-Glu-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys Write the sequence using one-letter abbreviations. sequence: TKPIVAPMEYGK Estimate the net charge on the peptide at pH 7. charge at pH 7: Estimate the net charge on the peptide at pH 12. Alpha helices are a type of secondary structure in proteins. What is the length of a 23.0 kDa single-stranded a-helical protein segment? Assume a mean residue mass of 110 Da. length: Beta () sheets are a type of secondary structure...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
From N to C terminus, name the amino acids in the polypeptide shown below using single-letter...
From N to C terminus, name the amino acids in the polypeptide shown below using single-letter codes. (Do not use punctuation marks or spaces to separate the letter (ie. if the 3 amino acids are A, B and C, write the sequence as ABC) 0 - 0- CH3 6- H₃C CH₂ Han CH2 CH2 CH-CH3 CH2 CH3 CH2 CH2 NH3 Which of the following is NOT a naturally occurring amino acid? OA) H3NCH-Coo OB) H3NCH-Coo CH2 он Oc) HNCH-Coo CH-OH...
Write the sequence of the peptide in single letter
abbreviation.
он н H н N н он н N н НО. HN HAN NH2
Write the sequence (single letter abbreviation) of the peptide (6 Points) H N SH H ZI N H H
6. A peptide has the sequence Cys-His-Phe-Glu-Ala-Arg a. Write the single letter sequence of the peptide b. Calculate the percentage and indicate the charge of the predominant peptide species at pH 6.5. Use the following pKa values: pKa Cys = 8.3, pKa N-terminus = 10.8, pKa His =6.0, pKa Glu = 4.3, pKa Arg = 12.5, pKa C-terminus =2.0 c. What is the charge of the peptide at pH 4.3? d. Draw the chemical structure of the predominant peptide species...
please answer thoroughly and correctly thjs js my last try
Vasopressin is a peptide hormone synthesized by the hypothalamus; in its reduced form it has the structure shown. NH2 HS H H₂N н NH2 SH H NH2 OH Vasopressin NH *H N NH2 This structure is incorrect in that one of the amino acids is shown in the D-configuration, rather than the L. Which one is it? What is the amino acid sequence of this peptide? CYFONCPRG Enter your answer...
16) Below is a tripeptide. A) Using arrows, identify the two peptide bonds. (2 pts) SH H₂N OH Ноо Glutamic acid Cysteine Glycine B) Give the amino acid sequence using the amino acid three letter abbreviations for the tripeptide. (2 pts)
-HAPTER 4 CLAUOVOR " Tyrosine O Asparticauid Ho iX !! HOH Peptide Bond Alanie Y qoo Guysine Сн, / сн. н сH, Hн fan-e--c-coo- alpha HH OH OH H Carbon How many amino acid residues are in this structure? 48 amino acid residles How many peptide bonds are in this structure? 3 Peptide bonds What is the name of the C terminal residue? Gusine What is the one-letter abbreviation of the N-terminal residue? What is the sequence, given in three-letter...
help with these please
Examine the peptide. Thr-Glu-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys Write the sequence using one-letter abbreviations. sequence: TKPIVAPMEYGK Estimate the net charge on the peptide at pH 7. charge at pH 7: Estimate the net charge on the peptide at pH 12. Alpha helices are a type of secondary structure in proteins. What is the length of a 23.0 kDa single-stranded a-helical protein segment? Assume a mean residue mass of 110 Da. length: Beta () sheets are a type of secondary structure...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
From N to C terminus, name the amino acids in the polypeptide shown below using single-letter codes. (Do not use punctuation marks or spaces to separate the letter (ie. if the 3 amino acids are A, B and C, write the sequence as ABC) 0 - 0- CH3 6- H₃C CH₂ Han CH2 CH2 CH-CH3 CH2 CH3 CH2 CH2 NH3 Which of the following is NOT a naturally occurring amino acid? OA) H3NCH-Coo OB) H3NCH-Coo CH2 он Oc) HNCH-Coo CH-OH...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago