Question

Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How
0 0
Add a comment Improve this question Transcribed image text
✔ Recommended Answer
Answer #1

1. (a) Two mutations are- (i) Deletion, (ii) Insertion

(b) Both of this mutation causes change in the DNA sequence and as well as in the RNA sequence which also can change the amino acid sequence. So that the functional protein can be mutated.

(c) In case of the deletion mutation the DNA base pair is got deleted or removed but incase of the insertion mutation the DNA new base pair is been added in the old DNA sequence.

2. This type of mutation is called 'Silent mutation'.

Because this type of muatation does not make any change in the protein structure which means the mutation causes no change so that it is called the silent mutation where as other mutation causes change in the protein structure and function.

3. (a)  Serine has more than one codon.

(b) Methionine has only one codon.

4. (a) After deleting the first H-

TEFAT CATATE THERAT

(b) No the sentence does not have any meaning.

(c) In this mutation one latter has been deleted which means it is 'Deletion mutation'.

5. The codon expresses the protein are-

#1. AGU UUA GCA ACG AGA UCA- Ser-Leu-Ala-Thr-Arg-Ser

#2. UCG CUA GCG ACC AGU UCA- Ser-Leu-Ala-Thr-Ser-Ser

#3. AGC CUC GCC ACU CGU AGU- Ser-Leu-Ala-Thr-Arg-Ser

So the two codon which codes for same protein are #1 & #3.

Add a comment
Know the answer?
Add Answer to:
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...

    Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • D) Consider that during replication of the cell. the following mutations were generated within the gene...

    D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...

  • Use the genetic code table to answer the following question: Second Base First Base Third Base...

    Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

  • You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio...

    You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC...

    you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT