Describe how dideoxynucleotides are used for sequencing DNA.
Describe how dideoxynucleotides are used for sequencing DNA.
Homework Answers
dideoxynucleotides are used for sequencing DNA (ddNTPs such as ddATP, ddCTP, ddTTP and ddGTP)
Sanger's method utilizes ddNTPs, DNA pol, single stranded DNA template and RNA primer. It actually utilized for chain termination.
ddNTPs are specially designed nucleotides have H attached to 3' carbon. This method causes chain termination as ddNTPs does not form the phosphodiester bond with the next deoxynucleotide. Here ddNTPs are fluorescently or radiolabeled.
In 4 samples of reaction, different(separately) ddNTPs are added along with normal dNTPs. This is followed by DNA extension by bound primer and then DNA fragments get heat denatured separated by size by gel electrophoresis. The DNA bands then visualized by autoradiography or by UV and the DNA sequence can easily be read off X-ray film or gel image.
-Explain how DNA sequencing can be used to identify organisms and place them into phylogenetic trees...
-Explain how DNA sequencing can be used to identify organisms and place them into phylogenetic trees or "trees of life". -Why would whole genome sequencing be better than sequencing parts of the bird genomes? -Besides humans, what group of animals would you recommend sequencing next and why? Justify your answer with some reasons.
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
How has DNA-sequencing technology evolved in response to the emerging needs of genome scientists? Drag the...
How has DNA-sequencing technology evolved in response to the emerging needs of genome scientists? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. Reset Help reduce speed sequencing methods, a single serves as a template. In one such strategy, the DNA polymerase is tethered in a nanopore and fluorescently labeled nucleotides are detected as they are incorporated. The overall goal is to and accuracy of sequencing...
09. Describe specific molecular techniques that detect DNA, mRNA or polypeptide. Identify specific probes used for...
09. Describe specific molecular techniques that detect DNA, mRNA or polypeptide. Identify specific probes used for the detection of the corresponding macromolecules. Is there a technique available to identify a protein that interacts with DNA sequence? (10 points) Q10A. Differentiate between two types of DNA sequencing methodologies, sequencing by chain termination and next generation sequencing. (5 points)
The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause...
The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause them to emit a different colour. In this case A = red/triangle, T = green, G = purple/circle and C = black. Based on the image of the gel, what was the sequence of synthesized strand? (The top of the gel is where the DNA was loaded - the negatively charged end) IDOL O III ODDITIO Select one: O a. 3'GACAAGCTTCGTACCAACAGGTCT 5' O O...
Why are next-generation DNA sequencing technologies known as sequencing-by-synthesis? Why are next-generation DNA sequencing technologies known...
Why are next-generation DNA sequencing technologies known as sequencing-by-synthesis? Why are next-generation DNA sequencing technologies known as sequencing-by-synthesis? The complete DNA strands are synthesized then sequenced. Numerous synthesized fragments of DNA are sequenced to determine which nucleotides were incorporated. The sequencing occurs during S phase of the cell cycle. RNA molecules are synthesized off of the DNA templates and the incorporated nucleotides are then determined. Incorporated nucleotides are determined while they are being added to a growing DNA strand.
Even though you are sending your plasmid to Eton Bio for sequencing, if you were setting...
Even though you are sending your plasmid to Eton Bio for sequencing, if you were setting up a Sanger sequencing reaction, each reaction should include template DNA, nucleotides (dNTPs), dideoxynucleotides (ddNTPs), reaction buffer, DNA polymerase, and _____. (A) Forward and reverse primers (B) Forward or reverse primers (C) Forward and reverse probes (D) Forward or reverse probes
Q1) List the limitations and challenges of dideoxy termination method of DNA sequencing? Q2) In the...
Q1) List the limitations and challenges of dideoxy termination method of DNA sequencing? Q2) In the context of mutation detection, describe the differences between first- and second-generation sequencing? Q3) 6-year-old child presenting with sensorineural deafness, sequencing of MYO15A gene by Sanger method was performed and showed the following chromatogram: A- Describe the principle of Sanger sequencing method? B- Describe the DNA change: position, type of variant and genotype?
The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG....
The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG. The number of DNA fragments resulting from a tube containing all the normal deoxyribonucleotides along with dideoxyCTP added is expected to be: 06 05 08
DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make...
DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make a library, and why you would use each one in respect to cost, size, % error, etc. Consider budget, what you want to get out of it, and is there merit to combine different technologies together?
How has DNA-sequencing technology evolved in response to the emerging needs of genome scientists? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. Reset Help reduce speed sequencing methods, a single serves as a template. In one such strategy, the DNA polymerase is tethered in a nanopore and fluorescently labeled nucleotides are detected as they are incorporated. The overall goal is to and accuracy of sequencing...
09. Describe specific molecular techniques that detect DNA, mRNA or polypeptide. Identify specific probes used for the detection of the corresponding macromolecules. Is there a technique available to identify a protein that interacts with DNA sequence? (10 points) Q10A. Differentiate between two types of DNA sequencing methodologies, sequencing by chain termination and next generation sequencing. (5 points)
The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause them to emit a different colour. In this case A = red/triangle, T = green, G = purple/circle and C = black. Based on the image of the gel, what was the sequence of synthesized strand? (The top of the gel is where the DNA was loaded - the negatively charged end) IDOL O III ODDITIO Select one: O a. 3'GACAAGCTTCGTACCAACAGGTCT 5' O O...
The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG. The number of DNA fragments resulting from a tube containing all the normal deoxyribonucleotides along with dideoxyCTP added is expected to be: 06 05 08
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago