Question

3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’.

A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector.

5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’

3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’

To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band) in which dideoxyA had been added to the growing strand?  

Answer 1

The primer will bind to the DNA strand at the 'bottom' i.e.

3'-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5'.

It will bind at the yellow mark of the mentioned strand below

3’-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’

from a direction of 3' to 5' as the primer itself will bind according to 5' to 3' direction.

Based on the sequence above , the newly formed DNA strand will comprise at least the sequence of GGATCCATGACTAGTCCGAC plus one dideoxy nucleotide (ddNTP). A total number of 21 DNA strands will be formed by this method through the addition of a dideoxy ddNTP at the end. Each time a gradual increase in the number of NTP in the strand will increase the molecular weight of the strand and that will be determined in capillary gel electrophoresis.