Question

21) You have this small piece of sequence data from a portion of your favorite gene that was isolated fronm a ladybug cDNA library. The spaces are to help with counting and the part not show in the midle () is 263 bp. 5 tca tta tgg tgt ttg agt aca tga aac acg gag atc tca ac.. agg tgo gaa tgg cag acg gac age aga gtt 3 a) Design forward and reverseprimersfor PCR that will isolate EXACTLY the sequence that is in bold typeface. Guidelines Make your primers 18 bp long Write your primers in 5 to 3 direction Forward 5 Reverse 5 3 3 You get your primers, and you test them in a PCR reaction on your cDNA library. b) What size band do you expect when you run out the PCR products out on an agarose gel? bp
0 0
Add a comment Improve this question Transcribed image text
Answer #1

a)

While designing primers, the sequence of the forward primer is same as that of the region to be amplified and the sequence of the reverse primer is complimentary to the strand when read from 3' - 5' direction. Thus, the sequence of forward and reverse primer would be :-

Forward : 5'-ttgagtacatgaaacacg- 3'

Reverse : 5'- gctgtccgtctgccattc -3'

b)

The band size of the PCR products would be the length of the gene/sequence to be amplified. In this case, it would be 323 bp.

Add a comment
Know the answer?
Add Answer to:
21) You have this small piece of sequence data from a portion of your favorite gene...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence fil...

    Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or...

  • PART C.  Use your codon chart to determine the amino acid sequence.  Remember to read through the strand...

    PART C.  Use your codon chart to determine the amino acid sequence.  Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop.  Follow example below: Example:                  DNA à  AGA CGG TAC CTC CGG TGG GTG CTT  GTC  TGT  ATC CTT  CTC  AGT  ATC               mRNA à  UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG               protein à                   start - glu – ala –thre – hist – asp –glu – threo - stop                                                                                                                                               acid                              acid 5.   DNA à  CTA TTA CGA TAC...

  • You are using PCR to amplify a 300 bp target sequence, a portion of Gene X,...

    You are using PCR to amplify a 300 bp target sequence, a portion of Gene X, from human genomic DNA isolated from patients' blood samples. The instructions for this procedure tell you to include Samples A and B, whose contents are listed below, with each batch of patient samples that you run. Ingredients Sample A Sample B 10x PCR Buffer (Tris,KCI,MgCl2,BSA) 5 mL 5 mL H2O 37.8mL 38.8mL dNTP's 3 mL 3 mL Taq DNA polymerase 0.2 mL 0.2 mL...

  • We understand that your diagram will not be able to portray the bands to their exact base-pair si...

    We understand that your diagram will not be able to portray the bands to their exact base-pair size, and that in some cases you may not be able to calculate an exact size for your bands. Just do your best in terms of positioning the bands in the lanes with respect to the standard markers, but please do not panic if the bands are a couple of mm away from perfect in your diagram. LABEL each band with its size...

  • e) (2 points) Your supervisor suggests you produce a cDNA library for the yeast in order...

    e) (2 points) Your supervisor suggests you produce a cDNA library for the yeast in order to produce the genes in bacteria and perform enzymatic analysis. You do so and are able to isolate a vector for your gene (you call this gene Yuml). You send your vector in for sequencing and are given the sequence of your gene and surrounding regions (shown below). 5' TCCGGCGGAATTCCAAGGCCT 3' AGGCCGCCTTAAGGTTCCGGA Yum1 CGTCGACTCCGGC GCAGCTGAGGCCG 3' 5' You want to PRC amplify your specific...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT