What are the START and STOP codons of the COVID-19 S-protein? ATG and TGA ATG and...

Question

Question

science biology

Answer 1

Similar Homework Help Questions

what is the significance of the start and stop codons in protein synthesis ?

what is the significance of the start and stop codons in protein synthesis ?
A tryptophan tRNA gene mutates so that it recognizes one of the three possible stop codons...

A tryptophan tRNA gene mutates so that it recognizes one of the three possible stop codons – TGA now codes for Trp, according to the mutant tRNA. a) Will all proteins in the cell be affected by this mutation? Briefly explain your answer; if not all proteins will be affected, estimate about what fraction of proteins will be affected. b) Gene X encodes the stop with TGA. How will this mutation affect the protein X that is produced? c) Will...
A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode...

A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode a chemokine receptor gene. The scientist is examining the sequence to identify potential open reading frames (ORFs), which contain both a start and stop codon. Using the partial sequence of chimpanzee DNA below, identify the total number of ORFs. Genetic Code 5 CCATGCACCAGATCGCTTATTAAAT 3 Codon ATG TAA TAG TGA Amino Acid Met - Start Stop Stop Stop Number

mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
You want to make a live virus vaccine against the COVID-19 virus by using zoonotic coronaviruses,...

You want to make a live virus vaccine against the COVID-19 virus by using zoonotic coronaviruses, i.e. coronaviruses that currently infect other species and therefore grow poorly in humans. i) What is the advantage of using a virus for the vaccine instead of just injecting spike protein from the COVID-19 virus ii) You obtain the DNA sequence of two coronaviruses that infect bats or foxes. The partial sequence of the spike protein from the human virus, and from these two...
Why can’t eukaryotic genes be used to express protein in bacteria? a. They lack stop codons...

Why can’t eukaryotic genes be used to express protein in bacteria? a. They lack stop codons b. They are too large c. They use different nucleic acids in their DNA d. They contain introns e. They cannot be replicated

17) Regarding the structure of the COVID-19 Spike Protein below. 3 pts a. What are the...

17) Regarding the structure of the COVID-19 Spike Protein below. 3 pts a. What are the blue things in A? b. In B, what oligomeric state is the spike protein in? c. In B, the orange molecule bound to spike is the human receptor called? 500 1000 1500 Seconds 2000 2500 3000 0 10 20 30 40 50 60 70 80 90 Temperature ("C) 17) Regarding the structure of the COVID-19 Spike Protein below. 3 pts a. What are the...
COVID 19 and DNA molecule? What kind of virus is COVID - 19? What does that...

COVID 19 and DNA molecule? What kind of virus is COVID - 19? What does that mean in terms of what processes happen inside the cells for it to spread to other cells inside the body? Explain the significance of this observation. The average length of a transcription unit along a eukaryotic DNA molecule is about 8000 nucleotides, whereas an average sized protein is about 400 amino acids long.
This is all on COVID 19 and viruses What is/are the symptom(s) of COVID-19? fever cough...

This is all on COVID 19 and viruses What is/are the symptom(s) of COVID-19? fever cough shortness of breath all of the above Question 2 What group(s) is most at risk from COVID-19? (Choose all that apply) Infants people 20-60 People 60 and older People with severe health conditions. QUESTION 3 A virus enters a cell to get food replicate DNA or RNA get water make a person sick QUESTION 4 What are two symptoms of a severe case of...

1. Summarize the main features or characteristics of the genetic code, including start & stop codons....

1. Summarize the main features or characteristics of the genetic code, including start & stop codons. 2. What is meant by base pair “wobble” and why might it be beneficial? 3. Describe the synthesis (and specificity) of aminoacyl-tRNA’s. 4. Name & describe the details in each of the three stages of protein synthesis, including the structure & functions of ribosomes and any factors involved. 5. Illustrate and/or describe the general structural, physical and/or chemical characteristics of amino acids. 6. Describe...