Question

Why can’t eukaryotic genes be used to express protein in bacteria? a. They lack stop codons...

Why can’t eukaryotic genes be used to express protein in bacteria?

a. They lack stop codons

b. They are too large

c. They use different nucleic acids in their DNA

d. They contain introns

e. They cannot be replicated

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

Option D) they contain introns

Generally eukaryotic genome is complex in nature when compared to prokaryotes. One main difference between prokaryotes and eukaryotes is prokaryotes do not have introns their transcription and translation process is coupled,whereas eukaryotes have introns (non coding sequence) and their genome is larger in size therefore in protein synthesis process , to produce a functional protein RNA processing and post translational process is required.

Therefore utilising eukaryotic Gene in bacteria ,bacteria can not process the eukaryotic Gene with introns leads to synthesis of inactive proteins.

Hope this helps you to resolve your doubts:)

kindly give your feedback.

Add a comment
Answer #2

The correct answer is d. They contain introns.

Eukaryotic genes contain introns, which are non-coding sequences within the gene that need to be removed during the process of gene expression. Bacteria lack the necessary machinery to accurately remove introns from eukaryotic genes. In contrast, bacteria have a simpler gene structure without introns, and their gene expression machinery is adapted to work with these non-intronic genes.

In addition to introns, eukaryotic genes may also have other regulatory sequences and elements that are specific to eukaryotic cells, which bacteria may not recognize or respond to appropriately. These differences in gene structure and regulation make it challenging for bacteria to correctly express proteins from eukaryotic genes.

Therefore, eukaryotic genes cannot be directly used to express proteins in bacteria without modifications or adaptations to overcome the presence of introns and other eukaryotic-specific elements.


answered by: mervetokaz
Add a comment
Know the answer?
Add Answer to:
Why can’t eukaryotic genes be used to express protein in bacteria? a. They lack stop codons...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Compared to prokaryotic genomes, eukaryotic genomes are usually A. smaller B. larger C. have more genes...

    Compared to prokaryotic genomes, eukaryotic genomes are usually A. smaller B. larger C. have more genes D. have fewer genes E. contain less noncoding DNA F. contain more noncoding DNA G. have higher gene density H. have lower gene density I. have introns J. do not have introns

  • Eukaryotic genes can be introduced into bacteria by recombinant DNA techniques. If the introduced gene encodes...

    Eukaryotic genes can be introduced into bacteria by recombinant DNA techniques. If the introduced gene encodes a protein that is also found in bacteria—for example, a universally used glycolysis enzyme—then expression of the eukaryotic gene may produce a protein that functions in the bacterial cell. In an experiment, the entire mouse gene for a glycolysis enzyme, including its promoter, coding regions and termination sequence, is introduced into an E. coli cell that has a mutant gene for the bacterial version...

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • In humans, there are about 200 different types of cells. Why are your liver cells different...

    In humans, there are about 200 different types of cells. Why are your liver cells different from skin cells, or neurons, or muscle cells? During development, each cell accumulates different mutations changing their DNA They produce the same proteins but some of those proteins are denatured in each cell They have different DNA and thus, each cell produces different proteins They produce the same kind of proteins but not all proteins are active in each cell They have the same...

  • 54. The advantage of a cDNA library of eukaryotic genes compared with a genomic library is...

    54. The advantage of a cDNA library of eukaryotic genes compared with a genomic library is that the cDNA library: a. always has the entire gene sequence b. lacks introns C. contains both introns and exons d. consists of single-stranded DNA e consists of RNA and DNA 55. Which of the following is an example of a cloning vector? a. Human growth hormone b. Mosquito c. Plasmid d. Tick e. Ribosomal RNA 56. Transformation in recombinant DNA technology: a. Requires...

  • Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in...

    Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...

  • 1. the genes that seem to be the most necessary to maintain, since they are present...

    1. the genes that seem to be the most necessary to maintain, since they are present in the smallest cellular organisms are a. cytoskeletal protein genes b, translation protein genes c. replication protein genes d. transcription protein genes e. DNA repair protein genes 2. Why do cellular organisms generally look very similar when early embryos but different from each other when mature? a. their DNAs have different chemistry b. their RNAs are different lengths c. what genes get turned on...

  • 1. Nucleic Acids a. What is the accepted central dogma? b. Write the codons for this...

    1. Nucleic Acids a. What is the accepted central dogma? b. Write the codons for this peptide: WINNER (uh, that would be me...!) c. Examine the DNA bases. Create TWO NEW ones, a purine and a pyrimidine. d. Examine the RNA bases. Create TWO NEW ones, a pyrimidine and a purine. e. For the amino acids YOU created, draw the NEW DNA nucleotide that is part of its codon (cannot be A, T, C, G, or 1) and the RNA...

  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT