Question

5. With regard to eukaryotic chromatin, what is a DNase hypersensitive site? What types of DNA...

5. With regard to eukaryotic chromatin, what is a DNase hypersensitive site? What types of DNA sequences tend to be located at these sites? How would you demonstrate experimentally that a specific sequence is located with a hypersensitive site/region? Describe and provide hypothetical results. What is an LCR?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

What is a DNase hypersensitive site?

DNase hypersensitive site is a short region of chromatin which has high sensitivity to cleavage by DNase I and various other nucleases (DNase II and micrococcal nucleases). In a hypersensitive site, the nucleosomal structure is less compacted, increasing the availability of the DNA to binding by proteins, such as transcription factors and DNase I. These sites account for many inherited tendencies.

What types of DNA sequences tend to be located at these sites?

In these specific regions of the genome, chromatin has lost its condensed structure, exposing the DNA and making it accessible. This raises the availability of DNA to degradation by enzymes, such as DNase I. As the most accessible regions of chromatin to non-histone DNA-binding proteins, DNase I hypersensitive sites generally denote those DNA sequences which have important functions in the nucleus.

How would you demonstrate experimentally that a specific sequence is located with a hypersensitive site/region?

DNaseI hypersensitivity assays can experimentally demonstrate this. This  DNaseI hypersensitivity assay involves treating chromatin briefly and with limiting amounts of DNaseI will cleave exposed hypersensitive sites. It is important to note that longer digestions or greater amounts of the enzyme will cleave the DNA of active genes at multiple sites, referred to as general DNaseI sensitivity.  Detection of the hypersensitive sites thus requires treating nuclei, containing intact chromatin, with limited amounts of DNaseI for a short period such that partial digestion is achieved, and then halting the digestion to prevent further DNA degradation. To map the cleavage sites, the DNA is isolated, digested with an appropriate restriction endonuclease, and analyzed by traditional Southern blotting. The hypersensitive sites are revealed by indirect end-labeling, using a short probe complementary to sequences near, or at the end of, the predicted restriction fragment. This produces a series of fragments and permits mapping of the cleavage sites to specific regions.

What is an LCR?

LCR is the locus control region (LCR). It is a long-range cis-regulatory element that enhances expression of linked genes at distal chromatin sites. It functions in a copy number-dependent manner and is tissue-specific, as seen in the selective expression of β-globin genes in erythroid cells. Expression levels of genes can be modified by the LCR and gene-proximal elements, such as promoters, enhancers, and silencers. The LCR functions by recruiting chromatin-modifying, coactivator, and transcription complexes.

Thank You!

Add a comment
Know the answer?
Add Answer to:
5. With regard to eukaryotic chromatin, what is a DNase hypersensitive site? What types of DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The observation that in any DNA sample, A T and G C A. DNase sequencing An...

    The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...

  • Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining...

    Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...

  • would you please help me with this question? 2. How does site specific recombination allow DNA...

    would you please help me with this question? 2. How does site specific recombination allow DNA to b What types of mobile elements can move around the genome? What enzymes catalyze the process? e exchanged between unrelated DNA sequences?

  • 8. With regard to microscopy: a. What are the different types and why are they useful?...

    8. With regard to microscopy: a. What are the different types and why are they useful? What is the magnification limit and resolving power of each? b. Explain the importance of resolution and know how it's calculated C. Describe the importance of magnification and contrast d. What are the ways to provide contrast? What are the specific stains, why is each used, and how do they work?

  • Questions 9-12 deal with SSR loci in Sam's genome. Remember that SSRs (simple sequence repeats) are...

    Questions 9-12 deal with SSR loci in Sam's genome. Remember that SSRs (simple sequence repeats) are tandem (next to each other) repeats of short sequences (a few bp). Such tandem repeats are located at specific sites scattered throughout the genome. Individuals vary in the number of repeats at each site sites can have up to 100 repeats. Each locus with the same repeats is called an SSR ocus DNA was extracted from Sam's white blood cells and cut with a...

  • choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...

    choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...

  • 1. Describe one experiment that can test the hypothesis that DNA replication is semi conservative. Describe...

    1. Describe one experiment that can test the hypothesis that DNA replication is semi conservative. Describe the results of this experiment if replication was conservative. And if it was distributive? 2. What type of chemical bond contributes to the specificity of base paring in the DNA? Are there any other chemical or physical factors in the structure o f the DNA molecule contributing to the thermodynamic stability of the DNA? 3. List the m ajor differences between DNA and RNA....

  • 4. The CRISPR-Cas9 system is an important new technique in molecular biology. What is the natural...

    4. The CRISPR-Cas9 system is an important new technique in molecular biology. What is the natural function of this system? Describe how you would use this system to generate a null mutation in another organism (i.e. explain Figure 6-43). How does it work? What is the modification of the method that allows for correction of a mutation (e.g. the mouse crystalline gene)? And lastly, what are the problems with the CRISPR system? FIGURE 6-43 Single-nucleotide mutations can be introduced into...

  • What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the...

    What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the DNA immediately upstream of the transcription start site, but expression of the gene can also be affected by control elements. These can be thousands of base pairs upstream of the promoter, grouped in an enhancer. Because the distance and spacing of these control elements make them difficult to identify, scientists begin by deleting sections of DNA that contain possible control elements and measuring the...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT