Question

Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size.

Below is a map of pBR22 plasmid. The position and base pair number of the recognitions sequence for different restriction enzymes is indicated. The fat arrows designate the position and size of several genes, for example, ampicillin and tetracycline resistance.

Using the attached plasmid restriction map answer the following questions.

  1. What is the size of the pBR322 plasmid?
  2. What is the size (in base pairs) of the ampicillin and tetracycline resistance genes?
  3. How many DNA fragments would you get when digested with the following enzymes? What would their sizes be?
    1. EcoRI
    2. HincII
    3. BtgI
    4. EcoRI + HincII
    5. EcoRI + BtgI
  4. If you were to run these digests on an agarose gel how would the gel look? (Draw a picture of the DNA fragments on the gel below). Blue boxes represent the wells that the digests would be loaded into. Label each well with what digest will be loaded into it. Don’t forget to include the marker!

Use the following as a marker (M)

Use the following as a marker (M) 10000

  

Post lab questions:

  1. Agarose gels can be used to study what size of DNA fragments?
  2. If agarose gel material is labeled as 1%, what does the 1% refer to?
  3. What causes the molecules to be separated on an agarose gel?
  4. Name two common DNA stains that are used to visualize DNA on an agarose gel?

RESTRICTION MAP: P.S. THERE IS NO MORE INFO. THIS IS ALL MY TEACHER GAVE US FOR INFO.

pBR322 GenBank Accession #J01749 See page 118 for ordering information PBR2 is an E.coli plasmid cloning vector containing th

0 0
Add a comment Improve this question Transcribed image text
Answer #1


plast - What is the size of PBR 3 22 An 436l be oR 4.361 kb. - what is the size in base pairs) of ampicillin and tetracyclinea) Eco R2 – A single-cut at 4352 bp loans 4359 linear DNA (частьr) DNA fragment al DNA size a 4361 be b) ninell - A single-cud) EcoRI & Hinell - 435 454 bp 3905 3859be toringuent - 2 fangenen No. of DNA fragment 22 agments size a ol. 2 3859be 02. 2 4Magher ce EcoRL Minell Byl Ecofl ecoll ninch att L.wells i Тоооо 80 + 6000+ $oot 400O1 3ooof 250of 2004 1500t 1 voot 7507 500

Add a comment
Know the answer?
Add Answer to:
Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb)....

    Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...

  • 8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was...

    8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook)....

  • A student clones a DNA fragment into the Sall site of pBR322. Sall is a restriction...

    A student clones a DNA fragment into the Sall site of pBR322. Sall is a restriction enzyme and pBR322 is the name of a plasmid (diagram below). Predict the media on which she could expect growth of E. coli containing the recombinant plasmid. Explain your answers. (16 pts) 2. EcoRI BamHI Pst Sall Ampicillin Tetracycline resistance (AmpR) resistance (TetR) pBR322 (4,361 bp) Origin of replication (ori) Pvull Media nutrient agar with ampicilin nutrient agar with tetracycline nutrient agar with ampicillin...

  • A plasmid is cleaved by restriction endonucleases and analyzed by agarose gel electrophoresis. Assume there is...

    A plasmid is cleaved by restriction endonucleases and analyzed by agarose gel electrophoresis. Assume there is no supercoiling. Answer the following three questions about the plasmid. Can you please help below? I also don't understand it so a explanation for each would be helpful. For the first one I think its 1000bp but unsure. For the second, I think there is 2 HindIII sites and for the last one there is 1 EcoRI site? Please explain. A plasmid is cleaved...

  • B4. Answer ALL parts: The diagram below shows the restriction pattern of a plasmid cut with...

    B4. Answer ALL parts: The diagram below shows the restriction pattern of a plasmid cut with the enzymes BamHI, EcoRI and Ndel. The digests are carried out with each enzyme alone and then with different combinations of the three enzymes. Enzyme Fragment sizes kb BamHI 1.4 10.6 EcoRI 4.5 7.5 Ndel 2.5 9.5 BamHI + EcoRI 45 3.4 1.4 BamHI + Ndel 1.4 2.5 5.9 EcoRI + Ndel 0.5 2.0 2.5 7.0 (a) Draw an agarose gel with restriction fragments...

  • The picture above represents an agarose gel that was used to analyze plasmid DNA after it...

    The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...

  • 7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S...

    7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S pts.). The gene fragment of interest was obtained by digestion of chromosomal DNA with the restriction enzyme Sall and subsequent purification using agarose gel electrophoresis. Which antiblotic would you use in the final step of the cloning procedure, and Pst why? EcoR Sal Ampicillin Tetracycline resistanica(Ter Amp) PBR322 4,361 bp) Origin of replicatiorn (ori Pvull 8. Assume that your gene fragment from question...

  • You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

    You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...

  • A polylinker increases the versatility of a DNA plasmid because it: (select all correct answers) A)...

    A polylinker increases the versatility of a DNA plasmid because it: (select all correct answers) A) facilitates the cloning of DNA segments. B) contains a DNA sequence that confers resistance to ampicillin. C) contains a DNA sequence to allow the vector to replicate. D)contains DNA recognition sequences for several different restriction enzymes. 2. You have an E. coli plasmid whose sequence contains three EcoRI restriction sites. How many DNA fragments would result from a complete EcoRI restriction enzyme digest? a....

  • please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping...

    please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT