Question

8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook). Molecular biologists cloned the gene sequences of insulin chain A and B polypeptides into PBR322. This plasmid is shown below (figure from https://www.ncb.com/products/n3033-pbr322-vector). You can find more information about individual restriction enzymes at https://www.neb.com/tools-and-resources/interactive- tools/enzyme-finder. EcoRI 4359 Aatll - Zral 4284 lal - Bspl 23 Bill 4209 Hindill 29 E 4205 EcoRV 185 Sspl 4168 Earl 4155 Bmtl - Nhel 229 Acul 4048 Bamill 375 Xmal 3961 Spri 409 Hincll 3905 Ball 471 Scal 3844 Full 445 Bl 3787 Bel 528 tl 3759 Pul 3733 Sphl 562 EcoNl 622 Pstl 3607 Sall-Accl - Hincll 651 Bsrl 3602 Nh N 712 Asel 3537 Eagl 939 Bsal 3433 11 949 Bsrl 3420 Nrul 972 PBR322 -BAPI 1045 Ahdi 3361 4,361 bp Bsp MI-Bull 1063 Noul 3000 NwNI 2884 PMI 1315 Bl 1353 PAMI 1354 Styl 1369 Aval - BsoBl 1425 PMI 1438 Miscl 1444 Btel 1447 Pull 1480 Regl 1650 HspEl 1654 BsaBl 1668 Bell 2777 B 2682 Del 2575 Peil - Af 2473 Bal 2404 Earl 2351 lepỌI - Sape 2350 Ndel 2295 BAP 2291 BsZ171- Accl 2244 sal 2225 Th11ll. Pfli 2217 Xmal 2029 Pull 2054 EsmBI 2122 Drdi 2162

Answer 1

PB R329., The, palindromic Sequences srecognised by Page 1 A) The gene insulin was inserted between ECORV and Novel sest section sites of the plasmid these restruction enzyme are ! 1. EcoRv 5'... GAT ATC...3' 3'....CTA. TAG.... 5 p. Noul s'... TCGCGA...3' s'... AGC GCT.... 5 The Sizes of the DNA fragments after treating the plasmid PBR32P with Ecory and Nust ore 787 bp and 3574bp. The size of the plasmid is 4361 bp. The restriction enzyous EcoRv and luol salt cuts at 187 bp and 974 bp. After digestion DNA fragments' of 787 bp (9746p - 187 bp = 787 bp) and 3574 bp (4361 bp-7875p - 3574bp) will be fărmed. B) PBR327 fos e antibiotic resistance gines, Ampic cillin ę tetracyclin. The insulin gene is inserted between the restruction sites,

Bsal and Acul. These sites are present in the Coding region of Ampicillin resistance gere & hence insertion of the insulin gene dissuepts ampicilin resistance. So, the recombinant plasmid transformed in to E. coli cells will have only tetraceplin antibiotic senistan c) The aminoacid Sequence of human insulin alais A is GIVE QccTsicsLY OLENYCN - gge ate gH gaa Cag toe act tet ate toe - tet ctt tac cag ett gag aae tac tgt aac. - GIVE QECTSIE SLYQLENYEN D) The minimal DNA insert that include start (ATG) & stop (TAA) signals is evential to Expres the À chain polypeptide in E.coli cells. DNA ineart for Blunt and cloning using the sest suction cogymes (Ecory and alvul) 5"ATGGGCATCGTTGAACAGTGTT GCACIT СТАТcТcТcтстTTACCA G ФСТА стеt A4 СТf9-3

Page-3. DNA insert for sticky end as directional cloning thing the sentenckiem argymes (EcoRI (GAAT Tc) and Hindell (AAGCTT). As these engyones produces sticky ends in the lector, Same estruction sites beeds to be added to the insulin gene at s before atart codon , ATG) & 5' (After stop Codon (TAA) ends in the gene. This allows ligation of the gene to the lector TATAT GAATTC ATG GGCATCGTIGA A CAGTGTT GCACTICTATCTGCT CT CTTTACCAGCTTGAGAA ĊTACTGEA ACTAA AAGETT-3'. please give a positive vote .