A) The gene of insulin (chain A) was inserted between the BamHI and SalI sites of pBR322. What are the sizes of the DNA fragments after treating pBR322 with BamHI and SalI?
B) To express the A chain polypeptide in E. coli, the inserted DNA also included transcriptional and translational start and stop signals. The coding strand of the gene for chain A is written below (5’ to 3’, left to right). GGCATCGTTGAACAGTGTTGCACTTCTATCTGCTCTCTTTACCAGCTTGAGAACTACTGTAAC What is the amino acid sequence of human insulin (chain A)? ______________________________________
C) Design a minimal DNA insert that would allow this polypeptide to be expressed in E. coli cells.
A. The sizes of the DNA fragments after treating pBR322 with BamH1 and Sall will be 4085 bp and 70 bp. Since the total pBR322 has 4361bp and about 276 bp will be lost during insertion of Chain A hence it will have 4085bp and the polypeptide chain with start and stop codon for insulin chain A contains approximately 79 bp for 21 amino acids and the start and stop codon. Hence the pBR322 cloned with insulin chain A will generate the two fragments of length provided above.
B. The amino acid sequence of human insulin Chain A for the given sequence is as follows.
G I V E Q C C T S I C S L Y Q L E N Y C N.
C. The minimal DNA insert that would allow this polypeptide to be expressed in E.coli cells will be AUG GGCATCGTTGAACAGTGTTGCACTTCTATCTGCTCTCTTTACCAGCTTGAGAACTACTGTAAC UAA.
The sequence along with the coding region for peptide A contains start and stop codon for translational initiation and termination.
A) The gene of insulin (chain A) was inserted between the BamHI and SalI sites of...
8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook)....
he full-length SNFI gene was inserted into pLexA at the BamHl restriction site to create pl.ex-Snf. To do this, the BamHI recognition sequence was introduced onto both the 5 and 3 ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 5' 3 SNF1 sense strand SNF1 antisense strand 3 5 Show the sequence that will result from BamHl digestion: 5" 3 SNF1 sense strand SNF1 antisense strand 3' 5 2. What are...
why is E the answer
Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P. (a) How can a probe be prepared to identify the gene for protein P? (b) If we have prepared a radioactive messenger RNA as our probe in part (a), how could we verify that it is the mRNA for protein P? (c) If...
QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to the 3' end of the mRNA molecule? A. Peptide bond B.5 phosphate group C.3" hydroxyl group D. Amino (N-terminus) E. Carboxyl (C-terminus) QUESTION 14 Which of the following is true regarding pre-mRNA modifications/processing? O A. Alternative splicing allows for increased complexity and synthesis of protein isomers OB. The 5' cap is added after RNA polymerase dissociates from the gene OC. The poly A tail...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
The extracted plasmid DNA is pUC19. Look up the plasmid map and
include in your pre-lab as well as your report.
a. What is the location of the BamH1 restriction site? Xmn1
restriction site? (sequence location by number). How many of these
sites exist each?
b. If single digestions were performed (one restriction enzyme)
with BamH1 and Xmn1, respectively, how many fragments would form,
and what would be the sizes of each of these fragments?
c. If a double digestion...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
33. Which of the following conditions are necessary for a gene to be expressed? A. condensed chromatin with DNA tightly coiled around nucleosomes B. open chromatin making the gene available for transcription C. specific signals from the environment D. active retrotransposons E. Both A and C are true F. Both B and C are true G. all of the above 34. Which of the following histone modifications results in more open chromatin? A. methylation B. acetylation C. restriction enzyme digest...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...