33. F. Both B and C
Gene expression takes place only when chromatin is less condensed. Highly compactable chromatin makes less availability of enzymes nedded for transcription, translation and gene expression. Gene expression mostly begins with transcription, but with activation of some environmental factors enzymes controlling gene expression can be activated.
34. E. All the above
Acetylation- it adds negative charge to lysine residueson the N terminal, it relaxes chromatin by repelling negatively charged DNA.
Methylation- It relaxes DNA by transcriptional activation and repression depending on the methylation site.
Resctrion Endonucleases- It cleaves the target genomic DNA sequence.
BAC fingerprinting - It uses restriction digested fingerprints of BAC cones to rearrange and detect the human genome.
35. B. Chromosome imprinting
Genes are expressed in parent of origin specific manner. It is maintained through mitotic cell divisions in somatic cell of the organism.
EMS mutagenesis- used to produce alleleic variation in the genes involved in the required metabolism.
36. C. DNA element is first transcribed to RNA, reverse transcribed back to DNA and then inserted back into the genome.
Transpons are genetic cmponents that copy and paste themselves to different genomic locations by reverse transcription using RNA transposition intermediate.
37. J. A, C and D
Non synonymous leads to amino acid replacing, Nonsense means stopping of gene expression using stop codons and by frame shift stoppage and either occur or not occur, because in here changing of nucleotide sequence takes place by either adding or deleting a base .
38. B. Synonymus
It is a silent mutaion.
33. Which of the following conditions are necessary for a gene to be expressed? A. condensed...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Which of the following statements about mutations are true? Select all that apply. Select one or more: a. Both substitution and indel mutations could result in a non-sense mutation in the affected codon following the mutational event. b. Indel mutations that occurred in an exon (translated part of the gene) can be silent. c. A substitution mutation can lead to a frameshift. d. Mutations are the only source for the origin of new alleles. Consider the wild-type DNA sequence: 3'...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation
of a defective gene c) introduction of a foreign gene (e g. from another species) d) e) None of the above 35. Which is NOT true about Gel electrophoresis: a) It is used to separate proteins as part of a Westem Blot Analysis b) It is used to separate DNA as part of a Southern Blot Analyss It is used to separate RNA as part of a Northern Blot Analysis It is used to separate restriction fragments in DNA e)...
Ul Ehé question paper. 1. Mutations can be caused by: a) tautomeric shifts b) UV light c) chemical changes to bases such as deaminatior C) all the above 2. The start of a wild type mRNA was AUGCCCAAGAccA mu tation This type of change resulted in the sequence AUGUCCAAGACC. is called a a) missense一®.frameshift mutation. 3. The typical rate of mutation for a human gene is per generation. a) 103 c) 10 d) 10-11 e) 104 4. If a hypothetical...
27. Alpha-helices and beta pleated sheets represent which structural level of proteins? A. primary B. secondary C. tertiary D. elementary E basal 28. Which of the following is the first step in translation? A Small 40S ribosome subunit with initiation factors binds to the 5' cap of the mRNA and scans for the start codon. B. The RNA carrying Methionine binds to the P site and the large 60S subunit binds to form the complete ribosome. C. Elongation factors deliver...
Bis
101 help
Question 6 1 pts 6. (1pts) The following DNA sequence 5- AGTCGCCCATGCCG-3'undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation D Question 7 2 pts 7.(2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...