Question

he full-length SNFI gene was inserted into pLexA at the BamHl restriction site to create pl.ex-Snf. To do this, the BamHI rec

0 0
Add a comment Improve this question Transcribed image text
Answer #1

ADHİ ou 6 ple x A irp Oru Conta LexA- n-one- t Com plemen ta d n

Add a comment
Know the answer?
Add Answer to:
He full-length SNFI gene was inserted into pLexA at the BamHl restriction site to create pl.ex-Sn...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...

    1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI recognition sequence was introduced onto both the 5' and 3' ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 3 SNF1 sense strand SNF1 antisense strand 5 3' Show the sequence that will result from BamHI digestion: 3 5' SNF1 sense strand SNF1 antisense strand 5" 1. The full-length SNFI...

  • The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, dige...

    The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...

  • III. Subclone the gene into plasmid, extract the plasmid DNA. 5. You know that your insert...

    III. Subclone the gene into plasmid, extract the plasmid DNA. 5. You know that your insert (gene of interest, GOI) is flanked by the EcoRI sites, which makes this restriction enzyme a perfect candidate to cut out your gene. You also know that the GOI has a unique BamH1 restriction site. After subcloning the PCR product into the plasmid, a purified DNA preparation of the plasmid is digested to completion with BamHI restriction endonuclease. In separate reactions, the same preparation...

  • Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb)....

    Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...

  • A) The gene of insulin (chain A) was inserted between the BamHI and SalI sites of...

    A) The gene of insulin (chain A) was inserted between the BamHI and SalI sites of pBR322. What are the sizes of the DNA fragments after treating pBR322 with BamHI and SalI? B) To express the A chain polypeptide in E. coli, the inserted DNA also included transcriptional and translational start and stop signals. The coding strand of the gene for chain A is written below (5’ to 3’, left to right). GGCATCGTTGAACAGTGTTGCACTTCTATCTGCTCTCTTTACCAGCTTGAGAACTACTGTAAC What is the amino acid sequence of...

  • You have cloned the Pepsi Gene into the vector pKEN. You used two restriction enzymes, BamHI...

    You have cloned the Pepsi Gene into the vector pKEN. You used two restriction enzymes, BamHI and EcoRI to force the cloning in a directional way. The plasmid (pKEN) is ~5 kb long and the insert Pepsi 800bp long. After transformation into E. coli you grow up several colonies and isolate the vector. After digestion of the vector it looks like you have three potential clones. You need to sequence the gene to make sure you have the correct clone....

  • please help if you can 3. You cloned a 20 kb piece of DNA, which contains...

    please help if you can 3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...

  • 1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...

    1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...

  • You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

    You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...

  • Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (uppe...

    Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the 5' end as possible. Indicate the specific sequences of bases for each endonuclease...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT