Question

6.You have identified a sequence of bases that corresponds to the regulatory protein for glycogen phosphorylase. Here is partIdentify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the 5' end as possible. Indicate the specific sequences of bases for each endonuclease using highlighting or underlining, and name the specific endonucleases. Note that we would normally want endonucleases to cut at both ends, but if you can answer this question I am confident you can also find an endonuclease for the 3' end (although this is not part of the question).


DNA about 25 bp from the recognition sequence. Bot types move along the DNA in a reaction that requires duced by cleaving gen

6.You have identified a sequence of bases that corresponds to the regulatory protein for glycogen phosphorylase. Here is part of that dsDNA sequence: 1 5'-TTGGAGTCGGATCCTTACTGCAGAATTTGCTTACGCGCTATTACTCGTTA 3-AACCTCAGCCTAGGAATGACGTCTTAAACGAATGCGCGATAATGAGCAAT 51 AAGGCTATCTACGATCAAATTTCCGATAGCTAGACCTTAGCTACTAGATC TTCCGATAGATGCTAGTTTAAAGGCTATCGATCTGGAATCGATGATCTAG 101 GGCGATAGCTAGATCGCGCGATAGCGATAGCTAGACTCCCTTAGAAATC CCGCTATCGATCTAGCGCGCTATCGCTATCGATCTGAGGGAATCTTTAG 151 TACTAGCTAGGCATCCTAGCTAGATCCCTAGAAGCTAGGGCTAGTGTGC ATGATCGATCCCTAGGATCGATCTAGGGATCTTCGATCCCGATCACACG 201AGAACACAGTAGCTCCGGATAGCTAGATCGGCGCGATAAATTATAGATC TCTTGTGTCATCGAGGCCTATCGATCTAGCCGCGCTATTTAATATCTAC 251GATAGTAGCCGTAAAGCTCGCGCGACGATAAGCTTCTAATCGATTTACG-3 CTATCATCGGCATTTCGAGCGCGCTGCTATTCGAAGATTAGCTAAATGC-5'
DNA about 25 bp from the recognition sequence. Bot types move along the DNA in a reaction that requires duced by cleaving genomic DNA with TABLE 9-2 Recognition Sequences for Some Type lI Restriction Endonucleases (5') AAGCTT8 TTCGAA HindIII (5') GGATCC (8') CCTAGG BamHI (5) GCGGCCGC) CGCCGGCG NotI (5) ATCGAT (3') TAGCT A Clal er pa thi le (5) CTGCAG(3) GACGT C PstI EcoRI (5) GAATTC (8') CTTAAG all re EcoRV (5) GATATC (3') CTATA G Pvull (5) CAGCTG@) GTCGAC th HaelII (5) GACNNNGC CTGNNNCAG Tthll1I CCG G Note: Arrows indicate the phosphodiester bonds cleaved by each restriction endonuclease. Asterisks indicate bases that are methylated by the corresponding methy N denotes any base. Note that the name of each enzyme consists of a three-letter abbreviation of the bacterial species from which it is derived, sometimes followed by a and roman numerals to distinguish different restriction endonucleases isolated from the same bacterial species. Thus BamHl is the first (1) restriction endonuclease c Bacillus amgloliquefaciens, strain H.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

From the list of restriction enzymes given in the provided table, EcoR V, PvuII, HaeII and Tth 1111 could not be use to digest the given DNA fragment as sticky end is required

BamHI and PstI are the two appropriate enzymes that could be use to digest the given DNA.

BamHI will cut the DNA very near to the 5' end. The position for restriction sites of BamHI are shown in the given image. The recognition sequence for BamHI is highlighted with red whereas the cutting site is indicated by the arrow.

Similarly, recognition sites for Pst 1 is highlighted in green and the cutting site is indicated by arrow (Below image)

The BamHI will cut the DNA at base position 9 whereas PstI will cut at base position 22.

STIGGAGICOLEATCCTACTOCALAATOCTA 3AACCTCAGCCTAGGAATGACGTCTTAAACGAAT

Add a comment
Know the answer?
Add Answer to:
Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (uppe...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the...

    The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3' 3' CCGG 5 5' AAGCTT 3 3' TTCGAA 5 5' RGGWCCY 3 3' YCCWGGR 5 Cleavage 5G AATTC 3' 3' CTTAA G 5'...

  • Need Part C answered only. The table shows where different restriction endonucleases (restriction enzymes) cleave DNA....

    Need Part C answered only. The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3' 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3 3' CCGG 5 5' AAGCTT 3' 3' TTCGAA 5 5'RGGWCCY 3 3' YCCWGGR 5 Cleavage 5'G AATTC 3'...

  • 5. If you are digesting a large linear fragment that is 300,000 bp in length. How...

    5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...

  • please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA...

    please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...

  • You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious...

    You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious disease in which children appear normal until age 14, at which time they begin to drool uncontrollably. Little is known about the genetics of HIDD, so you decide to do a study. You obtain a sample of DNA from the patient and a normal volunteer, and sequence the HIDD gene. The sequences are shown below: Key: Blue = C; Red = T; Green =...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

  • In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site....

    In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site. It has the and is responsible for identifying the precise nucleotide at which TATA box, TATAAA, transcription Pribnow box, TATAAT, transcription 0 0 0 0 0 Pribnow box, TATAAT, translation Pribnow bow, TTGACA, translation None of the answers are correct Ribosomes are made of: 1. rRNA 2. proteins 3. URNA 3 2 Both 1 and 2 are correct All answers are correct 1 Once...

  • 11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids...

    11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids Hydrolysis of salt Laboratory buffers, Polyprotie acids QUESTIONS 1. The DNA strand complementary to the strand 3-GTAGCGTAT-Y' would have the sequence a SLTACOCATAT-3 b.3.CATOXICATA-S c. 3-ATGCGTATA-S" ATATGCGTAS 2. When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base a. adenine b. guanine c uracil d. thyminee. typoxanthine 3. How many amino acids would be in...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT