Question

please answer question numbe 2.

Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II (A GATCT) Sal I (G TCGAC) Smal (CCC GGG) Xmal (C^CCGGG) EcoRK (GAT ATC), Clal (AT CGAT) SO 1) Find the sites that these enzymes recognize in the following sequence and mark the cut site in colored ink and label on top where the enzyme recognizes and binds. (6 points) ECORI GTCCATGGGAATTCACTAGCT example 5 AGCTCGGACTCATATGATATGCGGCCGCATCGAAATCGATTGAGGTACCATGCTAGATC ATCAAGCTTAATTTACTAGCTGGATCCCATCGATCAGATCTCATCGAGAATTCGACCTA CTGCAGCATTACGATATCCTAGCATCCATTTACGGACTCCCGGGAAGCTTCATGGGTAGCTA 3' 2) Four RE digests of the above DNA were run on a small acrylamide gel, draw the resulting gel. reaction/lane 1 - Not reaction/lane 2 = EcoRI/Sall reaction/lane 3 = Clal/ BamHI reaction/lane 4 - Pst HinDIII Draw the gel, show the wells, label the anode and the band sizes. (4 pts)

Answer 1

Question 2

Answer:

Gel image showing wells, anode and cathode and bands sizes of the fragments resulted from the restriction digestion.

Lane 1: NotI - two fragments of 158 and 22 bp will be formed.

Lane 2: EcoRI/SalI - two fragments of 107 and 73 will be formed. Sall restriction site is not there in sequence and hence it will not cut the sequence.

Lane 3: ClaI/BamHI - Four fragments of 91, 45, 36, 8 bp will be formed.

Lane 4: Pst/HinDIII - Four fragments of 63, 60, 40 and 17bp will be formed.

(-) CATHODE WELLS LANE = LANE2 = LANE 3 = LANE 4 = - 91 bp 63 bp 60 bp 45 bp 40 bp 22 bp + 17 bp (+) ANODE