Question

You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious...

You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious disease in which children appear normal until age 14, at which time they begin to drool uncontrollably. Little is known about the genetics of HIDD, so you decide to do a study. You obtain a sample of DNA from the patient and a normal volunteer, and sequence the HIDD gene. The sequences are shown below:

Key: Blue = C; Red = T; Green = A; Yellow =G

You are presented with a 14-year-old patient suffe

Enzyme list:

Eco RI: 5’-GAATTC-3’

Hind III: 5’-AAGCTT-3’

Pvu II: 5’-CAGCTG-3’

Xho I: 5’-CTCGAG-3’

Sal I: 5’-CTGCAG-3’

A) Determine the sequence of the WT allele (be sure to read from bottom up) and write it out. There are several mutations present in the HIDD allele – list these, and (after consulting the list of available restriction endonucleases) indicate which mutant sequence could be used to do RFLP analysis. Be sure to mention which enzyme you would have to use.

The sequences I got....

WT Allele

AGCTATCTAATGGGCGAACTCTAGGGACTTGCAAGGCTATTTCCCATAGT

HIDD

AGCTCTCTAATGGGCGAACTCGAGGGACTTGCAAGGCTATTGCCCATAGT

Xho I

I was told this (however, I'm not sure if it's correct... I'm not understanding the mutant sequences portion, I'm confused by where the "mutant sequences" GAGCTCT and TGCCCAT come from?..)

"The sequence of WT and HIDD alleles are correct. The mutant sequences are GAGCTCT, TGCCCAT. The enzyme XhoI can be used to cut the sequence at position 19. Of the two mutant sequences, GAGCTCT sequence is used where A in WT is replaced by C in HIDD and produces recognition sequence. Hence this enzyme cannot cut the WT sequence."

0 0
Add a comment Improve this question Transcribed image text
Answer #1

As you said the, the sequence from 19th nucleotide onwards in case of HIDD is different and is CTCGAG and if you want to cleave only HIDD gene leaving the WT allele, then you must slect the Xho I restriction enzyme. This will be useful to perform the RFLP analysis.

Add a comment
Know the answer?
Add Answer to:
You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (uppe...

    Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the 5' end as possible. Indicate the specific sequences of bases for each endonuclease...

  • please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA...

    please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...

  • AIDS (acquired immunodeficiency syndrome), caused by the HIV virus is very common in Zaire. The virus...

    AIDS (acquired immunodeficiency syndrome), caused by the HIV virus is very common in Zaire. The virus infects T cells of individuals by binding to a protein on the surface of T cells, named CCR5. Scientists observed that some people in Zaire never developed AIDS, even when they were exposed to the virus. They thought this could be due to the fact that CCR5 gene has two alleles in the Zairean population (CCR5-S (S); sensitive to AIDS; and CCR-R (R): resistant...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT