1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...

Question

Question

1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

BamHI sequence is GGATCC.

It produces a 5' overhang upon digestion by BamHI 5 3 5 GGATCC 3 5 GGATCC 3 SNF1 sense strand 3 CCTAGG 5 SNF1 antisense strand 5 3 Show the sequence that will result from

Add a comment

Answer 2

Similar Homework Help Questions

He full-length SNFI gene was inserted into pLexA at the BamHl restriction site to create pl.ex-Sn...

he full-length SNFI gene was inserted into pLexA at the BamHl restriction site to create pl.ex-Snf. To do this, the BamHI recognition sequence was introduced onto both the 5 and 3 ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 5' 3 SNF1 sense strand SNF1 antisense strand 3 5 Show the sequence that will result from BamHl digestion: 5" 3 SNF1 sense strand SNF1 antisense strand 3' 5 2. What are...
A) The gene of insulin (chain A) was inserted between the BamHI and SalI sites of...

A) The gene of insulin (chain A) was inserted between the BamHI and SalI sites of pBR322. What are the sizes of the DNA fragments after treating pBR322 with BamHI and SalI? B) To express the A chain polypeptide in E. coli, the inserted DNA also included transcriptional and translational start and stop signals. The coding strand of the gene for chain A is written below (5’ to 3’, left to right). GGCATCGTTGAACAGTGTTGCACTTCTATCTGCTCTCTTTACCAGCTTGAGAACTACTGTAAC What is the amino acid sequence of...
The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be...

The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be the recognition site on the complementary strand?

You have cloned the Pepsi Gene into the vector pKEN. You used two restriction enzymes, BamHI...

You have cloned the Pepsi Gene into the vector pKEN. You used two restriction enzymes, BamHI and EcoRI to force the cloning in a directional way. The plasmid (pKEN) is ~5 kb long and the insert Pepsi 800bp long. After transformation into E. coli you grow up several colonies and isolate the vector. After digestion of the vector it looks like you have three potential clones. You need to sequence the gene to make sure you have the correct clone....
“Unlike what happens in DNA replication, where both strands are copied, only one of the two...

“Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...

1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...

1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...

1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin...

ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin is 1,734 nucleotides in length and is located on the human chromosome 11. The mutation responsible for sickle-cell anemia affects a single nucleotide, which in turn changes a single amino acid. (9 pt) a. How are these nucleotides joined together to form a long polynucleotide chain? Name the relevant nucleotide constituents important for making the linkage. (see Slides 5-7 of Lecture 4b) (2 pt)...

3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in...

3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...

1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...

Homework Answers

Add Answer to:
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...

Post as a guest

Earn Coins

He full-length SNFI gene was inserted into pLexA at the BamHl restriction site to create pl.ex-Sn...

A) The gene of insulin (chain A) was inserted between the BamHI and SalI sites of...

The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be...

You have cloned the Pepsi Gene into the vector pKEN. You used two restriction enzymes, BamHI...

“Unlike what happens in DNA replication, where both strands are copied, only one of the two...

1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...

1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...

You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin...

3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in...

1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...

Homework Answers

Add Answer to: 1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...

Post as a guest

Earn Coins

Add Answer to:
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...