A plasmid used as a cloning vector in E. coli must
have…
Does sequence similarity between genes play an important role in
assigning gene function?
Successful insertion of a DNA fragment into the multi-cloning
region (restriction sites) of a recombinant plasmid is detected by
what changes?
Understand the concept of (restriction enzyme produced) DNA
fragment separation by gel electrophoresis.
In addition to restriction enzymes, which enzyme(s) are required to
insert a fragment of DNA into a cloning vector?
What is complementary DNA (cDNA) produced from (what is the
substrate for its synthesis)?
Understand Southern blotting assay in general. What can it be used
for?
Understand the processes of transformation, transfection,
conjugation and transduction.
Understand the different types of recognition sequences for
restriction enzymes (not the actual sequences).
Why has the Polymerase Chain Reaction revolutionized genetics? What
does it do?
In gel electrophoresis, which DNA fragment (in terms of size) would
migrate further from the sample well?
Understand gene knockout technology (in general, not the specific
players).
Can knockout mice serve as model organisms for study of human
disease?
Can insulin be created by recombinant DNA technology?
What is needed for a PCR reaction?
Understand applications for Genetic testing (who are candidates to
be tested with this technique).
What is a cDNA library?
1. A plasmid should possess the following
(1) an origin of replication, (2) a drug-resistance gene, and (3) a region where DNA can be inserted without interfering with plasmid replication or expression of the drug-resistance gene.
2. YES! sequence similarity between genes play an important role in assigning gene function that is homologous functions. The plasmid is inserted in bacteria and bacteria is cultured to check the presence of newly inserted DNA fragment.
3. Understand the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis.
4. Dna ligase will be necessary to rejoin the cut out DNA
5.cDNA is known to be synthesized, or manufactured from an mRNA or messenger RNA template. It is synthesized in a reaction that is catalyzed by the reverse transcriptase and DNA polymerase enzymes.
6. Southern blotting is designed to locate a particular sequence of DNA within a complex mixture. For example, Southern Blotting could be used to locate a particular gene within an entire genome. The amount of DNA needed for this technique is dependent on the size and specific activity of the probe
7.
In transformation, a bacterium takes up a piece of DNA floating in its environment.
In transduction, DNA is accidentally moved from one bacterium to another by a virus.
In conjugation, DNA is transferred between bacteria through a tube between cells.
Transfection is the process of deliberately introducing naked or purified nucleic acids into eukaryotic cell
8. four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors. Types I and III enzymes are similar in that both restriction and methylase activities are carried out by one large enzyme complex, in contrast to the type II system, in which the restriction enzyme is independent of its methylase. Type II restriction enzymes also differ from types I and III in that they cleave DNA at specific sites within the recognition site; the others cleave DNA randomly, sometimes hundreds of bases from the recognition sequence. Several thousand type II restriction enzymes have been identified from a variety of bacterial species. These enzymes recognize a few hundred distinct sequences, generally four to eight bases in length. Type IV restriction enzymes cleave only methylated DNA and show weak sequence specificity.
9. The polymerase chain reaction (PCR) revolutionized the field of molecular biology. From extremely tiny amounts of DNA, regions can be amplified into millions of copies for further analysis
10. Smaller molecules migrate through the gel more quickly and therefore travel further than larger fragments that migrate more slowly and therefore will travel a shorter distance.
11. A gene knockout is a genetic technique in which one of an organism's genes is made inoperative. However, it can also refer to the gene that is knocked out or the organism that carries the gene knockout. Knockout organisms or simply knockouts are used to study gene function, usually by investigating the effect of gene loss.
12. Yes because mice genome is very similar to human genome.
13. Recombinant DNA is a technology scientists developed that made it possible to insert a human gene into the genetic material of a common bacterium. This “recombinant” micro-organism could now produce the protein encoded by the human gene. THat is how Scientists harvest the insulin from the bacteria
14. For PCR there are five chemical componentsneeded, including a DNA template, DNA polymerase enzyme, primers, nucleotides and reaction buffer.
15. Genetic testing can provide information about a person's genes and chromosomes. tthe applications are
-Newborn screening is used just after birth to identify genetic disorders that can be treated early in life.
-Diagnostic testing is used to identify or rule out a specific genetic or chromosomal condition.
-Carrier testing is used to identify people who carry one copy of Forensic testing uses DNA sequences to identify an individual for legal purposes.a gene mutation that, when present in two copies, causes a genetic disorder.
-Prenatal testing is used to detect changes in a fetus's genes or chromosomes before birth.
-Preimplantation testing, also called preimplantation genetic diagnosis (PGD), is a specialized technique that can reduce the risk of having a child with a particular genetic or chromosomal disorder.
-Predictive and presymptomatic types of testing are used to detect gene mutations associated with disorders that appear after birth, often later in life
-Forensic testing uses DNA sequences to identify an individual for legal purposes.
16. cDNA library, mRNA is taken from specific cells of an organism, and then cDNA is made from that mRNA in a reaction which is catalyzed by an enzyme.
A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
QUESTION 11 a) The diagram below shows a typical plasmid cloning vector. There are three components ORI, amp and restriction enzyme recognition sizes. Explain the roles of each of these three components and explain why each is important for cloning genes. 6 marks] ORI Hindlll Sphl Pstl Sall Restriction Sites Xbal BamHI Smal Kpnl Sac EcoRI amp ORI role: importance: amp role: importance: Restriction sites role: importance: b) A technique called RT-PCR uses the enzyme reverse transcriptase (RT) in combination...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S pts.). The gene fragment of interest was obtained by digestion of chromosomal DNA with the restriction enzyme Sall and subsequent purification using agarose gel electrophoresis. Which antiblotic would you use in the final step of the cloning procedure, and Pst why? EcoR Sal Ampicillin Tetracycline resistanica(Ter Amp) PBR322 4,361 bp) Origin of replicatiorn (ori Pvull 8. Assume that your gene fragment from question...
RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To begin the recombinant DNA process, scientists must first ide at codes for the production of the protein they want to manufacture. One is to go backwards from the amino acid sequence of the desired protein to ide sequence of the gene. After scientists have identified the gene, they m it. Restriction enzymes or endonucleases from bacterial cells are key in th ia produce restriction...
The plasmid pFR55 is a useful vehicle for the cloning
of any DBA sequence in E. coli. A restriction map of pFR55 showing
the restriction enzyme cutting sites is shown below. The plasmid
can replicate I'm E. coli and carries the tetracycline resistance
Tc and ampicillin resistance (Ap) genes for use as selectable
markers in E. coli.
a. you wish to insert a gene into the SalI site of
pFR55. How would you select for E. Coli cells that have...
46. What enzyme is used to make cDNA a. Ribozyme b. Reverse transcriptase C. Taq polymerase d. Restriction endonuclease 47. Which of the following requires contact between a virus and a recipient bacterium for transfer of DNA? a. Crossing over b. Mutation c. Transduction d. Conjugation e. Transformation 48. In Recombinant DNA technology a vector is used to inserts the DNA into a host cell True/ False 49. If a foreign gene inserted into a plasmid inactivates the beta-galactosidase gene,...
every question
the process of nuclear transplantation used for animal cloning 9. What are stem cells? What are some of their uses: Chapter 12 1. Define: recombinant DNA cloning vector genetic engineering restriction enzymes 2. What is a GMO? 3. What are the advantages/disadvantages of using bacteria as a cloning vector? 4. List some important medical products that are produced using recombinant DNA technology
Below is a set of experiments for cloning the human growth hormone (HGH) gene and then expressing the HGH protein in E. coli starting from human pituitary glands and a tube of plasmid vector DNA. The plasmid expression vector contains the arabinose inducible expression system. Specify the correct order for carrying out these experiments, using the letter codes in front of each procedure. Use all of the steps in your answer, except for one step that should NOT be included....
please i need help with a, b, c
this is the sequence
5’ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA
AAGATCCTAACATTTTTGCGAG
TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGTCAAC
AAATGGAAGTTTATATTTAAATA
GTGATTTTAATTTAAATGAAGCATCCAACGAAAGCTTCTTAGAAAATTGCAATATCA
ATAGTTGTGTAGATATAGGTCAT
GAAAATGGCAACAAAATAAATAGTCAAGAAAATGAGCATGCTAAAAATAATAACA
ACAGTAATAATAACAATTTAAAACC
AGAATACAATAATAATAATAATAATTTAAAACCAGAATACAATAATAATAATTTAA
AACCAGAGTACAATAATAACAATT-3’
1. Polymerase chain reaction 5'- ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA AAGATCCTAACATTTTTGCGAG TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGTCAAC AAATGGAAGTTTATATTTAAATA GTGATTTTAATTTAAATGAAGCATCCAACGAAAGCTTCTTAGAAAATTGCAATATCA ATAGTTGTGTAGATATAGGTCAT GAAAATGGCAACAAAATAAATAGTCAAGAAAATGAGCATGCTAAAAATAATAACA ACAGTAATAATAACAATTTAAAACC AGAATACAATAATAATAATAATAATTTAAAACCAGAATACAATAATAATAATTTAA AACCAGAGTACAATAATAACAATT-3' a) One strand of a chromosomal DNA sequence is shown above. How would you amplify and isolate a DNA fragment defined by the sequence shown in red, using polymerase chain reaction. Design PCR primers (Forward and Reverse primers, each 20 nucleotides long, that...