Question

A polylinker increases the versatility of a DNA plasmid because it: (select all correct answers) A)...

A polylinker increases the versatility of a DNA plasmid because it: (select all correct answers)

A) facilitates the cloning of DNA segments.

B) contains a DNA sequence that confers resistance to ampicillin.

C) contains a DNA sequence to allow the vector to replicate.

D)contains DNA recognition sequences for several different restriction enzymes.

2. You have an E. coli plasmid whose sequence contains three EcoRI restriction sites. How many DNA fragments would result from a complete EcoRI restriction enzyme digest?

a. 1

b. 3

c. 4

d. 2

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
A polylinker increases the versatility of a DNA plasmid because it: (select all correct answers) A)...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • (Choose the best answer) A polylinker increases the versatility of a DNA plasmid because it contains:...

    (Choose the best answer) A polylinker increases the versatility of a DNA plasmid because it contains: a DNA recognition sequence for several different restriction enzymes. an antibiotic resistance cassette that allows selection in multiple different species. an origin of replication that is not organism-specific. a reverse transcriptase sequence. A BamHI restriction enzyme recognition sequence. cDNA libraries are the same as genomic libraries. include DNA from noncoding sequences. require DNA polymerase for their construction. require reverse transcriptase for their construction. are...

  • The plasmid pFR55 is a useful vehicle for the cloning of any DBA sequence in E....

    The plasmid pFR55 is a useful vehicle for the cloning of any DBA sequence in E. coli. A restriction map of pFR55 showing the restriction enzyme cutting sites is shown below. The plasmid can replicate I'm E. coli and carries the tetracycline resistance Tc and ampicillin resistance (Ap) genes for use as selectable markers in E. coli. a. you wish to insert a gene into the SalI site of pFR55. How would you select for E. Coli cells that have...

  • 1. Why do plasmid vectors contain a polylinker? So that the plasmid can be cut into...

    1. Why do plasmid vectors contain a polylinker? So that the plasmid can be cut into many small fragments to be inserted in the region of interest To allow the plasmid to survive on antibiotic media To find a restriction enzyme site that is useful for inserting the fragment of interest Multiple cut sites are required for the DNA fragment to be inserted. 2.What does blue color mean in blue-white screening with pUC18? The DNA fragment was successfully inserted into...

  • A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between...

    A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between genes play an important role in assigning gene function? Successful insertion of a DNA fragment into the multi-cloning region (restriction sites) of a recombinant plasmid is detected by what changes? Understand the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis. In addition to restriction enzymes, which enzyme(s) are required to insert a fragment of DNA into a cloning vector? What is...

  • please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping...

    please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

  • You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

    You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...

  • KpnI (255) lacz alpha gene ECORI (265) Psti (270) PUC origin Smal (3660) рвозобw 3973 bp...

    KpnI (255) lacz alpha gene ECORI (265) Psti (270) PUC origin Smal (3660) рвозобw 3973 bp EcoRI (875) Amp(R) Psti (1550) Kan(R) Ncol (1275) 8. You will be using the plasmid shown above as a vector for a DNA cloning experiment. You will create a library of genomic DNA fragments that will then be ligated into this plasmid. The plasmid carries two antibiotic resistance genes, Amp(R) and Kan(R), an origin of replication and a LacZ gene (Lac Z alpha). The...

  • 1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...

    1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...

  • colony which one express gene Only correct explanation not just answears pls. how to determine correct...

    colony which one express gene Only correct explanation not just answears pls. how to determine correct orientation by electrophoresis CORI -Hindi mal kpn ! Aggi -Hind III Gene CDNA EcoRI 5. G' AAT TC 3 CTTAAG. 5 Бра 5GGT ACC 3 3 CCATGG 5 pMAE2 Avr 11 M5 CCTAGGS 3 GGATCC.5 Arell ACCGGT 3 3.. TGGCCA...5 Amp Hind 1 5: AAGCTT 3 S 3. TTCGAA53 Xma C CGGG.3 GGGCGC 5 You try the following strategies in order to see if...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT