Question

Significant to complete loss of protein function vs partial to negligible loss of protein functionFrameshift mutation in the middle ofmperfect excision of a transposon that leaves a 10bp footprint in the first exon Deletion

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Significant to Complete Loss of Protein Function:

  • Frameshift mutation in the middle of a gene.
  • Imperfect excision of a transposon that leaves a 10bp footprint in the first exon.
  • Deletion of 2 base pairs just downstream of the start codon.
  • Missense mutation in a region of the gene that is required for proper folding/function of the protein.
  • Nonsense mutation in the third of fifteen exons.
  • Deletion of the promoter.

Partial to Negligible Loss of Protein Function:

  • Perfect excision of a transposon.
  • Silent mutation in a region of a gene that contains a conserved domain.
  • Deletion of 3 base pairs just upstream of the stop codon.
  • Replication slippage that deletes 10bp from the second intron.
  • Transversion in the first intron.
Add a comment
Know the answer?
Add Answer to:
Significant to complete loss of protein function vs partial to negligible loss of protein function Frameshift...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Using these types of genetic changes: Base substitution, Transition, Transversion, Missense mutation, Nonsense mutation, Insertion, Deletion,...

    Using these types of genetic changes: Base substitution, Transition, Transversion, Missense mutation, Nonsense mutation, Insertion, Deletion, Frameshift mutation Label these genetic changes (a-e). More than one answer may apply to each answer. a. GC->CG in the protein coding region on a gene. b. GC->TA in a GAA glutamate codon c. Loss of three bases GAA for a glutamate codon d. GC->CG in a tRNA gene e. GC->AT in the ribosome binding site of a mRNA

  • Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC...

    Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC - 3 The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein. Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein? Select the four correct answers. Deletion of...

  • 1) Suppose that gene A 3,000 bp. Suppose that g contained within intron 1 opposite directions...

    1) Suppose that gene A 3,000 bp. Suppose that g contained within intron 1 opposite directions for the two genes. covers 10,000 base pairs (bp) and has 2 exons; the intron in gene A is ene B covers 1,500 bp and has two exons. Gene B is completely of gene A. The direction of the transcriptional bubble moves in A. Draw the genomic organization (i.e., exons and introns) of gene A AND gene B. Label the polarity of the DNA...

  • Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton...

    Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79...

  • Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter ....

    Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....

  • 1. The following is a sequence of RNA. Do you expect it to adopt any kind...

    1. The following is a sequence of RNA. Do you expect it to adopt any kind of structure, and, if so, show what the structure would be? 5'-AUACUGCCCCCGGGGGAUGCCCGUAAACCGGGGUUACCCGGUUUAAACGGCCCCCCGGGGGCAGGCG-3'. 2. A dipoid yeast was ABD on one chromosome and abd on the other. The yeast cell underwent meiosis and the four genomes in the resulting tetrad were analyzed and determined to be: ABD, ABD, ABD and abd. a. For the moment, focus on the outcome regarding the number of B versus...

  • 13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A....

    13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A. Only ribonucleoside triphosphates contain the sugar ribose. B. Ribonucleoside triphosphates have low potential energy, making the polymerization reaction endergonic. C. Ribonucleoside triphosphates have high potential energy, making the polymerization reaction exergonic. D. Ribonucleoside monophosphates cannot form complementary base pairs with the DNA template. E. Ribonucleoside triphosphates are not used, rather all use deoxyriboside triphosphates. 14. How is a mutation in a bacterial cell that...

  • Assume that the The DNA changes provided above represent the sequences in the TEMPLATE STRAND. Determine...

    Assume that the The DNA changes provided above represent the sequences in the TEMPLATE STRAND. Determine what effect would mutation 3 have on the protein. For location of mutation- either "Present in mature RNA"or "Absent in mature RNA" For Amino Acids- three letters in upper case, if no amino acids are formed, write "NA", if stop codon is coded write "STOP" For type of change-write "missense", "nonsense", "silent", "neutral" or "NA" Location of mutation Amino acid for Amino acid Type...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT