Mutation 3
Elijah
Template 3' GTT 5'
mRNA 5' CAA 3'
Aminoacid Glutamine
Liam
Template 3' ATT 5'
mRNA 5' UAA 3'
Aminoacid Stop codon
This is nonsense mutation - Stop codon formed in middle of the exon and results in unmatured protein.

Assume that the The DNA changes provided above represent the sequences in the TEMPLATE STRAND. Determine...
Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79...
why is E the answer
Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
10. Examine more closely how DNA changes in a co questions. Write the codon for the DNA sequence ATA then change only one nucleotide so that it codes for an RNA codon that is a STOP codon. If a codon changes to cause an mRNA to have a STOP codon instead of a codon for an amino acid, what type of protein mutation is this? Write the RNA codon(s) for histidine then change the last letter to a "G." What...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning properly? photoreactivation repair base excision repair SOS repair double-strand break repair nucleotide excision repair 2. In bacteria and eukaryotes, a mutation is when ________. In bacteria and eukaryotes, a mutation is when ________. A.the nucleotide sequence in an mRNA molecule is directly changed B.the nucleotide sequence in a DNA molecule is directly changed C.the amino acid sequence in a protein molecule is directly changed...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....